Gene - combatTB X

dnaN

Type: protein_coding
Name: dnaN
Locus Name: Rv0002
Product: DNA polymerase III (beta chain) DnaN (DNA nucleotidyltransferase)
Functional Category: Information pathways
Location: 2052..3260 (+ strand)
Gene Length: 1208 bp
Nucleotides: TGGACGCGGCTACGACAAGAGTTGGCCTCACCGACTTGACGTTTCGTTTGCTACGAGAGTCTTTCGCCGATGCGGTGTCGTGGGTGGCTAAAAATCTGCCAGCCAGGCCCGCGGTGCCGGTGCTCTCCGGCGTGTTGTTGACCGGCTCGGACAACGGTCTGACGATTTCCGGATTCGACTACGAGGTTTCCGCCGAGGCCCAGGTTGGCGCTGAAATTGTTTCTCCTGGAAGCGTTTTAGTTTCTGGCCGATTGTTGTCCGATATTACCCGGGCGTTGCCTAACAAGCCCGTAGACGTTCATGTCGAAGGTAACCGGGTCGCATTGACCTGCGGTAACGCCAGGTTTTCGCTACCGACGATGCCAGTCGAGGATTATCCGACGCTGCCGACGCTGCCGGAAGAGACCGGATTGTTGCCTGCGGAATTATTCGCCGAGGCAATCAGTCAGGTCGCTATCGCCGCCGGCCGGGACGACACGTTGCCTATGTTGACCGGCATCCGGGTCGAAATCCTCGGTGAGACGGTGGTTTTGGCCGCTACCGACAGGTTTCGCCTGGCTGTTCGAGAACTGAAGTGGTCGGCGTCGTCGCCAGATATCGAAGCGGCTGTGCTGGTCCCGGCCAAGACGCTGGCCGAGGCCGCCAAAGCGGGCATCGGCGGCTCTGACGTTCGTTTGTCGTTGGGTACTGGGCCGGGGGTGGGCAAGGATGGCCTGCTCGGTATCAGTGGGAACGGCAAGCGCAGCACCACGCGACTTCTTGATGCCGAGTTCCCGAAGTTTCGGCAGTTGCTACCAACCGAACACACCGCGGTGGCCACCATGGACGTGGCCGAGTTGATCGAAGCGATCAAGCTGGTTGCGTTGGTAGCTGATCGGGGCGCGCAGGTGCGCATGGAGTTCGCTGATGGCAGCGTGCGGCTTTCTGCGGGTGCCGATGATGTTGGACGAGCCGAGGAAGATCTTGTTGTTGACTATGCCGGTGAACCATTGACGATTGCGTTTAACCCAACCTATCTAACGGACGGTTTGAGTTCGTTGCGCTCGGAGCGAGTGTCTTTCGGGTTTACGACTGCGGGTAAGCCTGCCTTGCTACGTCCGGTGTCCGGGGACGATCGCCCTGTGGCGGGTCTGAATGGCAACGGTCCGTTCCCGGCGGTGTCGACGGACTATGTCTATCTGTTGATGCCGGTTCGGTTGCCGGGCTGA
Drug Resistance: Check for drug resistance association at TBDREAMDB
Mutations: Check for mutants available at TARGET

Function

Confers DNA tethering and processivity to DNA polymerases and other proteins. Acts as a clamp, forming a ring around DNA (a reaction catalyzed by the clamp-loading complex) which diffuses in an ATP-independent manner freely and bidirectionally along dsDNA. Initially characterized for its ability to contact the catalytic subunit of DNA polymerase III (Pol III), a complex, multichain enzyme responsible for most of the replicative synthesis in bacteria; Pol III exhibits 3'-5' exonuclease proofreading activity. The beta chain is required for initiation of replication as well as for processivity of DNA replication (By similarity). Binds ds-and ssDNA (PubMed:22545130). Binds the antibiotic griselimycin and its derivatives with high affinity (1.0 x 10(-10) to 2.0 x 10(-10) M s(-1)) (PubMed:26045430). Binding occurs in a hydrophobic cleft between domains 2 and 3, which have been shown to be responsible for binding DNA polymerases and other DNA-modifying proteins (PubMed:26045430). {ECO:0000250|UniProtKB:P0A988, ECO:0000269|PubMed:22545130, ECO:0000269|PubMed:26045430}.

Family

Beta sliding clamp family

GO

response to antibiotic GO:0046677 biological_process
DNA polymerase III complex GO:0009360 cellular_component
DNA-directed DNA polymerase activity GO:0003887 molecular_function
cell wall GO:0005618 cellular_component
extracellular region GO:0005576 cellular_component
identical protein binding GO:0042802 molecular_function
3'-5' exonuclease activity GO:0008408 molecular_function
DNA binding GO:0003677 molecular_function
DNA strand elongation involved in DNA replication GO:0006271 biological_process
cytoplasm GO:0005737 cellular_component

InterPro

UniProt: P9WNU1
GenBank: Rv0002
EnsemblBacteria: Rv0002
Mycobrowser: Rv0002

Summary

Name: Beta sliding clamp (Beta clamp) (Sliding clamp) (Beta-clamp processivity factor) (DNA polymerase III beta sliding clamp subunit) (DNA polymerase III subunit beta) (Mtb beta-clamp)
Family: Beta sliding clamp family
Protein Sequence: MDAATTRVGLTDLTFRLLRESFADAVSWVAKNLPARPAVPVLSGVLLTGSDNGLTISGFDYEVSAEAQVGAEIVSPGSVLVSGRLLSDITRALPNKPVDVHVEGNRVALTCGNARFSLPTMPVEDYPTLPTLPEETGLLPAELFAEAISQVAIAAGRDDTLPMLTGIRVEILGETVVLAATDRFRLAVRELKWSASSPDIEAAVLVPAKTLAEAAKAGIGGSDVRLSLGTGPGVGKDGLLGISGNGKRSTTRLLDAEFPKFRQLLPTEHTAVATMDVAELIEAIKLVALVADRGAQVRMEFADGSVRLSAGADDVGRAEEDLVVDYAGEPLTIAFNPTYLTDGLSSLRSERVSFGFTTAGKPALLRPVSGDDRPVAGLNGNGPFPAVSTDYVYLLMPVRLPG
Mass: 42,113 Da
Length: 402 Aa

Rv0002 doesn't seem to be a targeted by any drug.

Homologous recombination mtu03440
mtu03440
Genetic Information Processing; Replication and repair

Mismatch repair mtu03430
mtu03430
The Escherichia coli MMR pathway has been extensively studied and is well characterized. In E. coli, the mismatch-activated MutS-MutL-ATP complex licenses MutH to incise the nearest unmethylated GATC sequence. UvrD and an exonuclease generate a gap. This gap is filled by pol III and DNA ligase. The GATC sites are then methylated by Dam. Several human MMR proteins have been identified based on their homology to E. coli MMR proteins. These include human homologs of MutS and MutL. Although E. coli MutS and MutL proteins are homodimers, human MutS and MutL homologs are heterodimers. The role of hemimethylated dGATC sites as a signal for strand discrimination is not conserved from E. coli to human. Human MMR is presumed to be nick-directed in vivo, and is thought to discriminate daughter and template strands using a strand-specific nick.

DNA replication mtu03030
mtu03030
Genetic Information Processing; Replication and repair

Antibiotics. Targeting DnaN for tuberculosis therapy using novel griselimycins.: Science. 2015 Jun 5;348(6239):1106-12. doi: 10.1126/science.aaa4690.
M. tuberculosis sliding beta-clamp does not interact directly with the NAD+-dependent DNA ligase.: PLoS One. 2012;7(4):e35702. doi: 10.1371/journal.pone.0035702. Epub 2012 Apr 24.
Crystal structure of DNA polymerase III beta sliding clamp from Mycobacterium tuberculosis.: Biochem Biophys Res Commun. 2011 Feb 11;405(2):272-7. doi: 10.1016/j.bbrc.2011.01.027. Epub 2011 Jan 8.
Proteogenomic analysis of Mycobacterium tuberculosis by high resolution mass spectrometry.: Mol Cell Proteomics. 2011 Dec;10(12):M111.011627. doi: 10.1074/mcp.M111.011445. Epub 2011 Oct 3.
Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence.: Nature. 1998 Jun 11;393(6685):537-44. doi: 10.1038/31159.
Organization of the origins of replication of the chromosomes of Mycobacterium smegmatis, Mycobacterium leprae and Mycobacterium tuberculosis and isolation of a functional origin from M. smegmatis.: Mol Microbiol. 1996 Apr;20(2):283-93.