Rv0008c
- Type
- protein_coding
- Name
- Rv0008c
- Locus Name
-
Rv0008c
- Product
-
Possible membrane protein
- Functional Category
-
Cell wall and cell processes
- Location
- 11874..12311 (- strand)
- Gene Length
- 437 bp
- Nucleotides
-
ATGAGTGAGCAGGTGGAAACCCGGTTGACCCCACGCGAGCGGCTGACCCGGGGTCTGGCCTACTCTGCGGTGGGTCCGGTGGACGTGACCCGAGGCCTCCTCGAACTCGGGGTCGGACTTGGGCTTCAGTCCGCCCGGTCGACCGCGGCCGGGCTTCGCCGCCGTTACCGGGAAGGCCGATTGGCCCGCGAGGTCGCTGCCGCCCAAGAGACGCTCGCTCAAGAGCTGACCGCTGCCCAGGACGTGGTGGCCAACCTACCGCAGGCCCTACAGGACGCCCGGACCCAACGTCGCAGCAAACACCACCTCTGGATCTTCGCGGGGATCGCGGCGGCCATCCTCGCCGGCGGTGCCGTCGCCTTCAGCATCGTCCGGCGCTCGTCGCGACCGGAGCCGTCGCCCCGACCACCGAGCGTCGAGGTGCAACCGCGCTCCTG
- Drug Resistance
- Mutations
- Function
- Required for regulated cell division, cell wall synthesis and the maintenance of cell shape. {ECO:0000255|HAMAP-Rule:MF_00927, ECO:0000269|PubMed:23002219}.
- Family
-
CwsA family
- GO
-
- cell cycle GO:0007049 biological_process
- cell wall biogenesis GO:0042546 biological_process
- integral component of plasma membrane GO:0005887 cellular_component
- regulation of cell shape GO:0008360 biological_process
- plasma membrane GO:0005886 cellular_component
- cell division GO:0051301 biological_process
- InterPro
Summary
- Name
- Cell wall synthesis protein CwsA (Cell wall synthesis and cell shape protein A)
- Family
- CwsA family
- Protein Sequence
-
MSEQVETRLTPRERLTRGLAYSAVGPVDVTRGLLELGVGLGLQSARSTAAGLRRRYREGRLAREVAAAQETLAQELTAAQDVVANLPQALQDARTQRRSKHHLWIFAGIAAAILAGGAVAFSIVRRSSRPEPSPRPPSVEVQPRS
- Mass
- 15,671 Da
- Length
- 145 Aa
Rv0008c doesn't seem to be a targeted by any drug.
Rv0008c doesn't seem to be involved in any pathway.
- Mycobacterium tuberculosis CwsA interacts with CrgA and Wag31, and the CrgA-CwsA complex is involved in peptidoglycan synthesis and cell shape determination.
- J Bacteriol. 2012 Dec;194(23):6398-409. doi: 10.1128/JB.01005-12. Epub 2012 Sep 21.
- Proteogenomic analysis of Mycobacterium tuberculosis by high resolution mass spectrometry.
- Mol Cell Proteomics. 2011 Dec;10(12):M111.011627. doi: 10.1074/mcp.M111.011445. Epub 2011 Oct 3.
- Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence.
- Nature. 1998 Jun 11;393(6685):537-44. doi: 10.1038/31159.