pknB



Type
protein_coding
Name
pknB
Locus Name

Rv0014c

Product

Transmembrane serine/threonine-protein kinase B PknB (protein kinase B) (STPK B)

Functional Category

Regulatory proteins

Location
15590..17470 (- strand)
Gene Length
1880 bp
Nucleotides
ATGACCACCCCTTCCCACCTGTCCGACCGCTACGAACTTGGCGAAATCCTTGGATTTGGGGGCATGTCCGAGGTCCACCTGGCCCGCGACCTCCGGTTGCACCGCGACGTTGCGGTCAAGGTGCTGCGCGCTGATCTAGCCCGCGATCCCAGTTTTTACCTTCGCTTCCGGCGTGAGGCGCAAAACGCCGCGGCATTGAACCACCCTGCAATCGTCGCGGTCTACGACACCGGTGAAGCCGAAACGCCCGCCGGGCCATTGCCCTACATCGTCATGGAATACGTCGACGGCGTTACCCTGCGCGACATTGTCCACACCGAAGGGCCGATGACGCCCAAACGCGCCATCGAGGTCATCGCCGACGCCTGCCAAGCGCTGAACTTCAGTCATCAGAACGGAATCATCCACCGTGACGTCAAGCCGGCGAACATCATGATCAGCGCGACCAATGCAGTAAAGGTGATGGATTTCGGCATCGCCCGCGCCATTGCCGACAGCGGCAACAGCGTGACCCAGACCGCAGCAGTGATCGGCACGGCGCAGTACCTGTCACCCGAACAGGCCCGGGGTGATTCCGTCGACGCCCGATCCGATGTCTATTCCTTGGGCTGTGTTCTTTATGAAGTCCTCACCGGGGAGCCACCTTTCACCGGCGACTCACCCGTCTCGGTTGCCTACCAACATGTGCGCGAAGACCCGATCCCACCTTCGGCGCGGCACGAAGGCCTCTCCGCCGACCTGGACGCCGTCGTTCTCAAGGCGCTGGCCAAAAATCCGGAAAACCGCTATCAGACAGCGGCGGAGATGCGCGCCGACCTGGTCCGCGTGCACAACGGTGAGCCGCCCGAGGCGCCCAAAGTGCTCACCGATGCCGAGCGGACCTCGCTGCTGTCGTCTGCGGCCGGCAACCTTAGCGGTCCGCGCACCGATCCGCTACCACGCCAGGACTTAGACGACACCGACCGTGACCGCAGCATCGGTTCGGTGGGCCGTTGGGTTGCGGTGGTCGCCGTGCTCGCTGTGCTGACCGTCGTGGTAACCATCGCCATCAACACGTTCGGCGGCATCACCCGCGACGTTCAAGTTCCCGACGTTCGGGGTCAATCCTCCGCCGACGCCATCGCCACACTGCAAAACCGGGGCTTCAAAATCCGCACCTTGCAGAAGCCGGACTCGACAATCCCACCGGACCACGTTATCGGCACCGACCCGGCCGCCAACACGTCGGTGAGTGCAGGCGACGAGATCACAGTCAACGTGTCCACCGGACCCGAGCAACGCGAAATACCCGACGTCTCCACGCTGACATACGCCGAAGCGGTCAAGAAACTGACTGCCGCCGGATTCGGCCGCTTCAAGCAAGCGAATTCGCCGTCCACCCCGGAACTGGTGGGCAAGGTCATCGGGACCAACCCGCCAGCCAACCAGACGTCGGCCATCACCAATGTGGTCATCATCATCGTTGGCTCTGGTCCGGCGACCAAAGACATTCCCGATGTCGCGGGCCAGACCGTCGACGTGGCGCAGAAGAACCTCAACGTCTACGGCTTCACCAAATTCAGTCAGGCCTCGGTGGACAGCCCCCGTCCCGCCGGCGAGGTGACCGGCACCAATCCACCCGCAGGCACCACAGTTCCGGTCGATTCAGTCATCGAACTACAGGTGTCCAAGGGCAACCAATTCGTCATGCCCGACCTATCCGGCATGTTCTGGGTCGACGCCGAACCACGATTGCGCGCGCTGGGCTGGACCGGGATGCTCGACAAAGGGGCCGACGTCGACGCCGGTGGCTCCCAACACAACCGGGTCGTCTATCAAAACCCGCCGGCGGGGACCGGCGTCAACCGGGACGGCATCATCACGCTGAGGTTCGGCCAGTA
Drug Resistance

Check for drug resistance association at TBDREAMDB

Mutations

Check for mutants available at TARGET


Function
Protein kinase that regulates many aspects of mycobacterial physiology, and is critical for growth in vitro and survival of the pathogen in the host (PubMed:24706757). Is a key component of a signal transduction pathway that regulates cell growth, cell shape and cell division via phosphorylation of target proteins such as GarA, GlmU, PapA5, PbpA, FhaB (Rv0019c), FhaA (Rv0020c), MviN, PstP, EmbR, Rv1422, Rv1747 and RseA (PubMed:15978616, PubMed:15985609, PubMed:15987910, PubMed:16436437, PubMed:16817899, PubMed:16980473, PubMed:19121323, PubMed:19826007, PubMed:20025669, PubMed:21423706, PubMed:22275220). Also catalyzes the phosphorylation of the core proteasome alpha-subunit (PrcA), and thereby regulates the proteolytic activity of the proteasome (PubMed:25224505). Is a major regulator of the oxygen-dependent replication switch since PknB activity is necessary for reactivation of cells from the hypoxic state (PubMed:24409094). Shows a strong preference for Thr versus Ser as the phosphoacceptor. Overexpression of PknB alters cell morphology and leads to cell death (PubMed:24706757) (PubMed:24409094). {ECO:0000269|PubMed:15978616, ECO:0000269|PubMed:15985609, ECO:0000269|PubMed:15987910, ECO:0000269|PubMed:16436437, ECO:0000269|PubMed:16817899, ECO:0000269|PubMed:16980473, ECO:0000269|PubMed:19121323, ECO:0000269|PubMed:19826007, ECO:0000269|PubMed:20025669, ECO:0000269|PubMed:21423706, ECO:0000269|PubMed:22275220, ECO:0000269|PubMed:24409094, ECO:0000269|PubMed:24706757, ECO:0000269|PubMed:25224505}.
Family

Protein kinase superfamily, Ser/Thr protein kinase family

GO
InterPro

UniProt
P9WI81
GenBank
Rv0014c
EnsemblBacteria
Rv0014c
Mycobrowser
Rv0014c


1MRU
Summary
Name
Serine/threonine-protein kinase PknB (EC 2.7.11.1)
Family
Protein kinase superfamily, Ser/Thr protein kinase family
Protein Sequence
MTTPSHLSDRYELGEILGFGGMSEVHLARDLRLHRDVAVKVLRADLARDPSFYLRFRREAQNAAALNHPAIVAVYDTGEAETPAGPLPYIVMEYVDGVTLRDIVHTEGPMTPKRAIEVIADACQALNFSHQNGIIHRDVKPANIMISATNAVKVMDFGIARAIADSGNSVTQTAAVIGTAQYLSPEQARGDSVDARSDVYSLGCVLYEVLTGEPPFTGDSPVSVAYQHVREDPIPPSARHEGLSADLDAVVLKALAKNPENRYQTAAEMRADLVRVHNGEPPEAPKVLTDAERTSLLSSAAGNLSGPRTDPLPRQDLDDTDRDRSIGSVGRWVAVVAVLAVLTVVVTIAINTFGGITRDVQVPDVRGQSSADAIATLQNRGFKIRTLQKPDSTIPPDHVIGTDPAANTSVSAGDEITVNVSTGPEQREIPDVSTLTYAEAVKKLTAAGFGRFKQANSPSTPELVGKVIGTNPPANQTSAITNVVIIIVGSGPATKDIPDVAGQTVDVAQKNLNVYGFTKFSQASVDSPRPAGEVTGTNPPAGTTVPVDSVIELQVSKGNQFVMPDLSGMFWVDAEPRLRALGWTGMLDKGADVDAGGSQHNRVVYQNPPAGTGVNRDGIITLRFGQ
Mass
66,510 Da
Length
626 Aa

Fostamatinib DB12010


Rv0014c doesn't seem to be involved in any pathway.


The structure of PknB extracellular PASTA domain from mycobacterium tuberculosis suggests a ligand-dependent kinase activation.
Structure. 2010 May 12;18(5):606-15. doi: 10.1016/j.str.2010.02.013.
Auto-activation mechanism of the Mycobacterium tuberculosis PknB receptor Ser/Thr kinase.
EMBO J. 2008 Dec 3;27(23):3186-97. doi: 10.1038/emboj.2008.236. Epub 2008 Nov 13.
The structure of PknB in complex with mitoxantrone, an ATP-competitive inhibitor, suggests a mode of protein kinase regulation in mycobacteria.
FEBS Lett. 2006 May 29;580(13):3018-22. doi: 10.1016/j.febslet.2006.04.046. Epub 2006 Apr 27.
Structure of Mycobacterium tuberculosis PknB supports a universal activation mechanism for Ser/Thr protein kinases.
Nat Struct Biol. 2003 Mar;10(3):168-74. doi: 10.1038/nsb897.
Crystal structure of the catalytic domain of the PknB serine/threonine kinase from Mycobacterium tuberculosis.
J Biol Chem. 2003 Apr 11;278(15):13094-100. doi: 10.1074/jbc.M300660200. Epub 2003 Jan 27.
Mycobacterium tuberculosis Ser/Thr protein kinase B mediates an oxygen-dependent replication switch.
PLoS Biol. 2014 Jan;12(1):e1001746. doi: 10.1371/journal.pbio.1001746. Epub 2014 Jan 7.
Phosphorylation regulates mycobacterial proteasome.
J Microbiol. 2014 Sep;52(9):743-54. doi: 10.1007/s12275-014-4416-2. Epub 2014 Sep 2.
Protein kinase B (PknB) of Mycobacterium tuberculosis is essential for growth of the pathogen in vitro as well as for survival within the host.
J Biol Chem. 2014 May 16;289(20):13858-75. doi: 10.1074/jbc.M114.563536. Epub 2014 Apr 4.
A phosphorylated pseudokinase complex controls cell wall synthesis in mycobacteria.
Sci Signal. 2012 Jan 24;5(208):ra7. doi: 10.1126/scisignal.2002525.
Structural insight into the Mycobacterium tuberculosis Rv0020c protein and its interaction with the PknB kinase.
Structure. 2011 Oct 12;19(10):1525-34. doi: 10.1016/j.str.2011.07.011.
The extracytoplasmic domain of the Mycobacterium tuberculosis Ser/Thr kinase PknB binds specific muropeptides and is required for PknB localization.
PLoS Pathog. 2011 Jul;7(7):e1002182. doi: 10.1371/journal.ppat.1002182. Epub 2011 Jul 28.
Phosphorylation of Mycobacterium tuberculosis Ser/Thr phosphatase by PknA and PknB.
PLoS One. 2011 Mar 9;6(3):e17871. doi: 10.1371/journal.pone.0017871.
Proteogenomic analysis of Mycobacterium tuberculosis by high resolution mass spectrometry.
Mol Cell Proteomics. 2011 Dec;10(12):M111.011627. doi: 10.1074/mcp.M111.011445. Epub 2011 Oct 3.
Allosteric activation mechanism of the Mycobacterium tuberculosis receptor Ser/Thr protein kinase, PknB.
Structure. 2010 Dec 8;18(12):1667-77. doi: 10.1016/j.str.2010.09.019.
RseA, the SigE specific anti-sigma factor of Mycobacterium tuberculosis, is inactivated by phosphorylation-dependent ClpC1P2 proteolysis.
Mol Microbiol. 2010 Feb;75(3):592-606. doi: 10.1111/j.1365-2958.2009.07008.x. Epub 2009 Dec 16.
PknB-mediated phosphorylation of a novel substrate, N-acetylglucosamine-1-phosphate uridyltransferase, modulates its acetyltransferase activity.
J Mol Biol. 2009 Feb 20;386(2):451-64. doi: 10.1016/j.jmb.2008.12.031. Epub 2008 Dec 24.
Forkhead-associated domain-containing protein Rv0019c and polyketide-associated protein PapA5, from substrates of serine/threonine protein kinase PknB to interacting proteins of Mycobacterium tuberculosis.
J Biol Chem. 2009 Dec 11;284(50):34723-34. doi: 10.1074/jbc.M109.058834. Epub 2009 Oct 13.
The serine/threonine kinase PknB of Mycobacterium tuberculosis phosphorylates PBPA, a penicillin-binding protein required for cell division.
Microbiology. 2006 Feb;152(Pt 2):493-504. doi: 10.1099/mic.0.28630-0.
The Ser/Thr protein kinase PknB is essential for sustaining mycobacterial growth.
J Bacteriol. 2006 Nov;188(22):7778-84. doi: 10.1128/JB.00963-06. Epub 2006 Sep 15.
EmbR, a regulatory protein with ATPase activity, is a substrate of multiple serine/threonine kinases and phosphatase in Mycobacterium tuberculosis.
FEBS J. 2006 Jun;273(12):2711-21. doi: 10.1111/j.1742-4658.2006.05289.x.
Mycobacterium tuberculosis serine/threonine kinases PknB, PknD, PknE, and PknF phosphorylate multiple FHA domains.
Protein Sci. 2005 Jul;14(7):1918-21. doi: 10.1110/ps.051413405.
Proteomic identification of M. tuberculosis protein kinase substrates: PknB recruits GarA, a FHA domain-containing protein, through activation loop-mediated interactions.
J Mol Biol. 2005 Jul 29;350(5):953-63. doi: 10.1016/j.jmb.2005.05.049.
The Mycobacterium tuberculosis serine/threonine kinases PknA and PknB: substrate identification and regulation of cell shape.
Genes Dev. 2005 Jul 15;19(14):1692-704. doi: 10.1101/gad.1311105. Epub 2005 Jun 28.
Conserved autophosphorylation pattern in activation loops and juxtamembrane regions of Mycobacterium tuberculosis Ser/Thr protein kinases.
Biochem Biophys Res Commun. 2005 Aug 5;333(3):858-67. doi: 10.1016/j.bbrc.2005.05.173.
Expression and characterization of the Mycobacterium tuberculosis serine/threonine protein kinase PknB.
Infect Immun. 1999 Nov;67(11):5676-82.
PknB kinase activity is regulated by phosphorylation in two Thr residues and dephosphorylation by PstP, the cognate phospho-Ser/Thr phosphatase, in Mycobacterium tuberculosis.
Mol Microbiol. 2003 Sep;49(6):1493-508.
Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence.
Nature. 1998 Jun 11;393(6685):537-44. doi: 10.1038/31159.