ssb
- Type
- protein_coding
- Name
- ssb
- Locus Name
-
Rv0054
- Product
-
Single-strand binding protein Ssb (helix-destabilizing protein)
- Functional Category
-
Information pathways
- Location
- 58586..59080 (+ strand)
- Gene Length
- 494 bp
- Nucleotides
-
TGGCTGGTGACACCACCATCACCATCGTCGGAAATCTGACCGCTGACCCCGAGCTGCGGTTCACCCCGTCCGGTGCGGCCGTGGCGAATTTCACCGTGGCGTCAACGCCCCGGATCTATGACCGTCAGACCGGCGAATGGAAAGACGGCGAAGCGCTGTTCCTCCGGTGCAATATCTGGCGGGAGGCGGCCGAGAACGTGGCCGAGAGCCTCACCCGGGGGGCACGAGTCATCGTTAGCGGGCGGCTTAAGCAGCGGTCGTTTGAAACCCGTGAGGGCGAGAAGCGCACCGTCATCGAGGTCGAGGTCGATGAGATTGGGCCTTCGCTTCGGTACGCCACCGCCAAGGTCAACAAGGCCAGCCGCAGCGGCGGGTTTGGCAGCGGATCCCGTCCGGCGCCGGCGCAGACCAGCAGCGCCTCGGGAGATGACCCGTGGGGCAGCGCACCGGCGTCGGGTTCGTTCGGCGGCGGCGATGACGAACCGCCATTCTGA
- Drug Resistance
- Mutations
- Function
- Unknown
- Family
-
Unknown
- GO
-
- response to antibiotic GO:0046677 biological_process
- extracellular region GO:0005576 cellular_component
- single-stranded DNA binding GO:0003697 molecular_function
- DNA replication GO:0006260 biological_process
- plasma membrane GO:0005886 cellular_component
- positive regulation of helicase activity GO:0051096 biological_process
- cellular response to DNA damage stimulus GO:0006974 biological_process
- InterPro
- Name
- Single-stranded DNA-binding protein (SSB)
- Family
- Unknown
- Protein Sequence
-
MAGDTTITIVGNLTADPELRFTPSGAAVANFTVASTPRIYDRQTGEWKDGEALFLRCNIWREAAENVAESLTRGARVIVSGRLKQRSFETREGEKRTVIEVEVDEIGPSLRYATAKVNKASRSGGFGSGSRPAPAQTSSASGDDPWGSAPASGSFGGGDDEPPF
- Mass
- 17,353 Da
- Length
- 164 Aa
Rv0054 doesn't seem to be a targeted by any drug.
-
-
Homologous recombination mtu03440
mtu03440Genetic Information Processing; Replication and repair
-
-
-
Mismatch repair mtu03430
mtu03430The Escherichia coli MMR pathway has been extensively studied and is well characterized. In E. coli, the mismatch-activated MutS-MutL-ATP complex licenses MutH to incise the nearest unmethylated GATC sequence. UvrD and an exonuclease generate a gap. This gap is filled by pol III and DNA ligase. The GATC sites are then methylated by Dam. Several human MMR proteins have been identified based on their homology to E. coli MMR proteins. These include human homologs of MutS and MutL. Although E. coli MutS and MutL proteins are homodimers, human MutS and MutL homologs are heterodimers. The role of hemimethylated dGATC sites as a signal for strand discrimination is not conserved from E. coli to human. Human MMR is presumed to be nick-directed in vivo, and is thought to discriminate daughter and template strands using a strand-specific nick.
-
-
-
DNA replication mtu03030
mtu03030Genetic Information Processing; Replication and repair
-
- Proteogenomic analysis of Mycobacterium tuberculosis by high resolution mass spectrometry.
- Mol Cell Proteomics. 2011 Dec;10(12):M111.011627. doi: 10.1074/mcp.M111.011445. Epub 2011 Oct 3.
- Structure of Mycobacterium tuberculosis single-stranded DNA-binding protein. Variability in quaternary structure and its implications.
- J Mol Biol. 2003 Aug 8;331(2):385-93.
- Characterization of an interplay between a Mycobacterium tuberculosis MazF homolog, Rv1495 and its sole DNA topoisomerase I.
- Nucleic Acids Res. 2010 Dec;38(22):8219-30. doi: 10.1093/nar/gkq737. Epub 2010 Aug 19.
- Cloning, over-expression and biochemical characterization of the single-stranded DNA binding protein from Mycobacterium tuberculosis.
- Eur J Biochem. 1999 Sep;264(2):591-8. doi: 10.1046/j.1432-1327.1999.00684.x.
- Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence.
- Nature. 1998 Jun 11;393(6685):537-44. doi: 10.1038/31159.