Gene - combatTB X

Rv0079

Type: protein_coding
Name: Rv0079
Locus Name: Rv0079
Product: Unknown protein
Functional Category: Conserved hypotheticals
Location: 88204..89025 (+ strand)
Gene Length: 821 bp
Nucleotides: TGGAACCGAAACGCAGTCGCCTCGTCGTATGTGCACCCGAGCCATCGCACGCGCGGGAATTCCCGGATGTCGCCGTATTCTCCGGCGGCCGGGCTAACGCATCCCAGGCCGAACGGTTGGCTCGTGCCGTGGGTCGCGTGTTGGCCGATCGGGGCGTCACCGGGGGTGCTCGGGTGCGGCTGACCATGGCGAACTGCGCCGATGGGCCGACGCTGGTGCAGATAAACCTGCAGGTAGGTGACACCCCATTAAGGGCGCAGGCCGCCACCGCGGGCATCGATGATCTGCGACCCGCACTGATCAGACTGGATCGACAGATCGTGCGGGCGTCGGCACAGTGGTGCCCCCGGCCTTGGCCGGATCGGCCCCGCCGGCGATTGACCACGCCGGCCGAGGCGCTAGTCACCCGCCGCAAACCGGTCGTGCTAAGGCGCGCAACCCCGTTGCAGGCGATTGCCGCTATGGACGCCATGGACTACGACGTGCATTTGTTCACCGACGCCGAGACGGGGGAGGACGCTGTGGTCTATCGGGCTGGACCGTCGGGGCTGCGGCTGGCCCGCCAGCACCACGTATTTCCCCCAGGATGGTCACGTTGTCGCGCCCCAGCCGGGCCGCCGGTGCCGCTGATTGTGAATTCGCGTCCGACACCGGTTCTCACGGAGGCCGCCGCGGTGGACCGGGCGCGCGAACATGGACTGCCATTCCTGTTTTTCACCGACCAGGCCACCGGCCGCGGCCAGCTGCTCTACTCCCGCTACGACGGCAACCTCGGGTTGATCACCCCGACCGGTGACGGCGTTGCCGACGGTCTGGCATGA
Drug Resistance: Check for drug resistance association at TBDREAMDB
Mutations: Check for mutants available at TARGET

Function

Involved in translation regulation (PubMed:19795912, PubMed:22719925). Inhibits protein synthesis and decreases bacterial growth when expressed in E.coli (PubMed:22719925). Can also stimulate macrophages and peripheral blood mononuclear cells (PBMC) to secrete important cytokines that may be significant in granuloma formation and its maintenance. Increases secretion of IFN-gamma, TNF-alpha, IL-1 beta and IL-8 through human Toll-like receptor 2 (TLR2) signaling pathway (PubMed:23819907). {ECO:0000269|PubMed:22719925, ECO:0000269|PubMed:23819907, ECO:0000305|PubMed:19795912}.

Family

Unknown

GO

cytosolic small ribosomal subunit GO:0022627 cellular_component
plasma membrane GO:0005886 cellular_component
negative regulation of translational elongation GO:0045900 biological_process
cell wall GO:0005618 cellular_component
ribosome binding GO:0043022 molecular_function
ribosomal small subunit binding GO:0043024 molecular_function
pathogenesis GO:0009405 biological_process

InterPro

UniProt: P9WMA9
GenBank: Rv0079
EnsemblBacteria: Rv0079
Mycobrowser: Rv0079

Summary

Name: Dormancy associated translation inhibitor (DATIN)
Family: Unknown
Protein Sequence: MEPKRSRLVVCAPEPSHAREFPDVAVFSGGRANASQAERLARAVGRVLADRGVTGGARVRLTMANCADGPTLVQINLQVGDTPLRAQAATAGIDDLRPALIRLDRQIVRASAQWCPRPWPDRPRRRLTTPAEALVTRRKPVVLRRATPLQAIAAMDAMDYDVHLFTDAETGEDAVVYRAGPSGLRLARQHHVFPPGWSRCRAPAGPPVPLIVNSRPTPVLTEAAAVDRAREHGLPFLFFTDQATGRGQLLYSRYDGNLGLITPTGDGVADGLA
Mass: 29,507 Da
Length: 273 Aa

Rv0079 doesn't seem to be a targeted by any drug.

Rv0079 doesn't seem to be involved in any pathway.

Dormancy Associated Translation Inhibitor (DATIN/Rv0079) of Mycobacterium tuberculosis interacts with TLR2 and induces proinflammatory cytokine expression.: Cytokine. 2013 Oct;64(1):258-64. doi: 10.1016/j.cyto.2013.06.310. Epub 2013 Jun 29.
Mycobacterium tuberculosis DosR regulon gene Rv0079 encodes a putative, 'dormancy associated translation inhibitor (DATIN)'.: PLoS One. 2012;7(6):e38709. doi: 10.1371/journal.pone.0038709. Epub 2012 Jun 13.
Proteogenomic analysis of Mycobacterium tuberculosis by high resolution mass spectrometry.: Mol Cell Proteomics. 2011 Dec;10(12):M111.011627. doi: 10.1074/mcp.M111.011445. Epub 2011 Oct 3.
Function prediction of Rv0079, a hypothetical Mycobacterium tuberculosis DosR regulon protein.: J Biomol Struct Dyn. 2009 Dec;27(3):283-92. doi: 10.1080/07391102.2009.10507316.
Heme oxygenase-1-derived carbon monoxide induces the Mycobacterium tuberculosis dormancy regulon.: J Biol Chem. 2008 Jun 27;283(26):18032-9. doi: 10.1074/jbc.M802274200. Epub 2008 Apr 9.
Mycobacterium tuberculosis senses host-derived carbon monoxide during macrophage infection.: Cell Host Microbe. 2008 May 15;3(5):323-30. doi: 10.1016/j.chom.2008.03.007.
Inhibition of respiration by nitric oxide induces a Mycobacterium tuberculosis dormancy program.: J Exp Med. 2003 Sep 1;198(5):705-13. doi: 10.1084/jem.20030205.
Regulation of the Mycobacterium tuberculosis hypoxic response gene encoding alpha -crystallin.: Proc Natl Acad Sci U S A. 2001 Jun 19;98(13):7534-9. doi: 10.1073/pnas.121172498.
Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence.: Nature. 1998 Jun 11;393(6685):537-44. doi: 10.1038/31159.