ldtA
- Type
- protein_coding
- Name
- ldtA
- Locus Name
-
Rv0116c
- Product
-
Probable L,D-transpeptidase LdtA
- Functional Category
-
Cell wall and cell processes
- Location
- 140267..141022 (- strand)
- Gene Length
- 755 bp
- Nucleotides
-
ATGCGTCGAGTGGTTCGTTATCTATCCGTTGTGGTCGCGATCACGCTGATGCTCACCGCGGAATCAGTCAGCATAGCGACCGCCGCGGTCCCGCCACTCCAACCGATCCCAGGCGTTGCGTCGGTGTCGCCGGCTAATGGTGCCGTGGTGGGGGTGGCGCACCCGGTGGTGGTGACATTCACCACGCCCGTGACCGATCGCCGCGCCGTCGAGCGGTCCATCCGCATCAGCACACCGCACAACACGACCGGACACTTCGAGTGGGTCGCTAGCAATGTCGTGCGGTGGGTGCCCCACCGGTATTGGCCACCTCACACCCGTGTCTCGGTGGGTGTGCAGGAACTGACCGAAGGATTCGAGACCGGTGACGCACTGATCGGGGTTGCCAGCATCTCGGCACATACCTTCACGGTCAGCAGAAACGGAGAAGTCCTCCGCACCATGCCCGCGTCGTTAGGCAAGCCCAGCCGCCCGACACCAATCGGTAGCTTTCACGCAATGTCCAAGGAGCGCACGGTCGTGATGGACTCGCGTACCATCGGCATCCCGCTGAATTCCTCGGACGGGTATCTGCTCACCGCCCACTACGCGGTTCGTGTTACCTGGAGCGGCGTGTACGTGCACTCGGCCCCCTGGTCGGTCAACTCGCAGGGATACGCCAACGTCAGCCACGGCTGTATCAACCTCAGCCCGGACAACGCGGCATGGTACTTCGACGCCGTCACCGTTGGTGATCCCATTGAGGTGGTCGGCTA
- Drug Resistance
- Mutations
- Function
- Generates 3->3 cross-links in peptidoglycan, catalyzing the cleavage of the mDap(3)-D-Ala(4) bond of a tetrapeptide donor stem and the formation of a bond between the carbonyl of mDap(3) of the donor stem and the side chain of mDap(3) of the acceptor stem. Is specific for donor substrates containing a stem tetrapeptide since it cannot use pentapeptide stems. Is thought to play a role in adaptation to the nonreplicative state of M.tuberculosis. {ECO:0000269|PubMed:18408028, ECO:0000269|PubMed:24041897}.
- Family
-
Unknown
- GO
-
- peptidoglycan L,D-transpeptidase activity GO:0071972 molecular_function
- cell wall organization GO:0071555 biological_process
- peptidoglycan-protein cross-linking GO:0018104 biological_process
- extracellular region GO:0005576 cellular_component
- regulation of cell shape GO:0008360 biological_process
- periplasmic space GO:0042597 cellular_component
- transferase activity, transferring acyl groups GO:0016746 molecular_function
- InterPro
4JMN
- Name
- L,D-transpeptidase 1 (LDT 1) (EC 2.3.2.-) (Ldt(Mt1))
- Family
- Unknown
- Protein Sequence
-
MRRVVRYLSVVVAITLMLTAESVSIATAAVPPLQPIPGVASVSPANGAVVGVAHPVVVTFTTPVTDRRAVERSIRISTPHNTTGHFEWVASNVVRWVPHRYWPPHTRVSVGVQELTEGFETGDALIGVASISAHTFTVSRNGEVLRTMPASLGKPSRPTPIGSFHAMSKERTVVMDSRTIGIPLNSSDGYLLTAHYAVRVTWSGVYVHSAPWSVNSQGYANVSHGCINLSPDNAAWYFDAVTVGDPIEVVG
- Mass
- 26,916 Da
- Length
- 251 Aa
Summary
Rv0116c doesn't seem to be a targeted by any drug.
Rv0116c doesn't seem to be involved in any pathway.
- Structures of free and inhibited forms of the L,D-transpeptidase LdtMt1 from Mycobacterium tuberculosis.
- Acta Crystallogr D Biol Crystallogr. 2013 Sep;69(Pt 9):1697-706. doi: 10.1107/S0907444913013085. Epub 2013 Aug 15.
- In vitro cross-linking of Mycobacterium tuberculosis peptidoglycan by L,D-transpeptidases and inactivation of these enzymes by carbapenems.
- Antimicrob Agents Chemother. 2013 Dec;57(12):5940-5. doi: 10.1128/AAC.01663-13. Epub 2013 Sep 16.
- Expression, purification, crystallization and preliminary X-ray crystallographic analysis of the L,D-transpeptidase LdtMt1 from Mycobacterium tuberculosis.
- Acta Crystallogr Sect F Struct Biol Cryst Commun. 2013 Mar 1;69(Pt 3):253-6. doi: 10.1107/S1744309112052141. Epub 2013 Feb 22.
- Inactivation of Mycobacterium tuberculosis l,d-transpeptidase LdtMt(1) by carbapenems and cephalosporins.
- Antimicrob Agents Chemother. 2012 Aug;56(8):4189-95. doi: 10.1128/AAC.00665-12. Epub 2012 May 21.
- Proteogenomic analysis of Mycobacterium tuberculosis by high resolution mass spectrometry.
- Mol Cell Proteomics. 2011 Dec;10(12):M111.011627. doi: 10.1074/mcp.M111.011445. Epub 2011 Oct 3.
- The peptidoglycan of stationary-phase Mycobacterium tuberculosis predominantly contains cross-links generated by L,D-transpeptidation.
- J Bacteriol. 2008 Jun;190(12):4360-6. doi: 10.1128/JB.00239-08. Epub 2008 Apr 11.
- Evaluation of a nutrient starvation model of Mycobacterium tuberculosis persistence by gene and protein expression profiling.
- Mol Microbiol. 2002 Feb;43(3):717-31.
- Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence.
- Nature. 1998 Jun 11;393(6685):537-44. doi: 10.1038/31159.