Rv0203
- Type
- protein_coding
- Name
- Rv0203
- Locus Name
-
Rv0203
- Product
-
Possible exported protein
- Functional Category
-
Cell wall and cell processes
- Location
- 241514..241924 (+ strand)
- Gene Length
- 410 bp
- Nucleotides
-
TGAAGACAGGCACCGCGACGACGCGGCGCAGGCTGTTGGCAGTACTGATCGCCCTCGCGTTGCCGGGGGCCGCCGTTGCGCTGCTGGCCGAACCATCAGCGACCGGCGCGTCGGACCCGTGCGCGGCCAGCGAAGTGGCGAGGACGGTCGGTTCGGTCGCCAAGTCGATGGGCGACTACCTGGATTCACACCCAGAGACCAACCAGGTGATGACCGCGGTCTTGCAGCAGCAGGTAGGGCCGGGGTCGGTCGCATCGCTGAAGGCCCATTTCGAGGCGAATCCCAAGGTCGCATCGGATCTGCACGCGCTTTCGCAACCGCTGACCGATCTTTCGACTCGGTGCTCGCTGCCGATCAGCGGCCTGCAGGCGATCGGTTTGATGCAGGCGGTGCAGGGCGCCCGCCGGTAG
- Drug Resistance
- Mutations
- Function
- Part of a heme-iron acquisition system. Acts by binding heme and delivering it to the membrane proteins MmpL3 and MmpL11. Can use free heme or heme from host hemoglobin. {ECO:0000269|PubMed:21383189, ECO:0000269|PubMed:22283334, ECO:0000269|PubMed:23760277}.
- Family
-
Unknown
- GO
-
- metal ion binding GO:0046872 molecular_function
- heme binding GO:0020037 molecular_function
- heme transport GO:0015886 biological_process
- extracellular region GO:0005576 cellular_component
- InterPro
3MAY
- Name
- Heme-binding protein Rv0203
- Family
- Unknown
- Protein Sequence
-
MKTGTATTRRRLLAVLIALALPGAAVALLAEPSATGASDPCAASEVARTVGSVAKSMGDYLDSHPETNQVMTAVLQQQVGPGSVASLKAHFEANPKVASDLHALSQPLTDLSTRCSLPISGLQAIGLMQAVQGARR
- Mass
- 13,901 Da
- Length
- 136 Aa
Summary
Rv0203 doesn't seem to be a targeted by any drug.
Rv0203 doesn't seem to be involved in any pathway.
- Discovery and characterization of a unique mycobacterial heme acquisition system.
- Proc Natl Acad Sci U S A. 2011 Mar 22;108(12):5051-6. doi: 10.1073/pnas.1009516108. Epub 2011 Mar 7.
- The Mycobacterium tuberculosis secreted protein Rv0203 transfers heme to membrane proteins MmpL3 and MmpL11.
- J Biol Chem. 2013 Jul 26;288(30):21714-28. doi: 10.1074/jbc.M113.453076. Epub 2013 Jun 11.
- Characterization of heme ligation properties of Rv0203, a secreted heme binding protein involved in Mycobacterium tuberculosis heme uptake.
- Biochemistry. 2012 Feb 21;51(7):1518-31. doi: 10.1021/bi2018305. Epub 2012 Feb 8.
- Proteogenomic analysis of Mycobacterium tuberculosis by high resolution mass spectrometry.
- Mol Cell Proteomics. 2011 Dec;10(12):M111.011627. doi: 10.1074/mcp.M111.011445. Epub 2011 Oct 3.
- Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence.
- Nature. 1998 Jun 11;393(6685):537-44. doi: 10.1038/31159.