cobU
- Type
- protein_coding
- Name
- cobU
- Locus Name
-
Rv0254c
- Product
-
Probable bifunctional cobalamin biosynthesis protein CobU: cobinamide kinase + cobinamide phosphate guanylyltransferase
- Functional Category
-
Intermediary metabolism and respiration
- Location
- 305825..306349 (- strand)
- Gene Length
- 524 bp
- Nucleotides
-
GTGCGGATACTGGTCACTGGCGGCGTCCGCTCGGGAAAGTCCACGCACGCCGAAGCGTTGTTGGGCGATGCGGCCGACGTCGTCTACGTCGCGCCTGGCCGCCCGGCCGCTGGCAGCGATCCCGATTGGGACGCCCGGGTCGCACTGCATCGCGCTCGCCGCCCACCGACCTGGCTAACGGTGGAAACGGCCGACGTCGCGACGGCTTTGTCCGAGGCACGAAGTCCCGTGCTCGTGGACTGCTTGGGCACCTGGCTGACGGCCATCATGGATGGCGAGGCGTTGTGGTCTGCTGCGACCGCGGACGTCTACGCCGTCCTCGAGGCACGGCTCGACGGGTTGTGCGCCGCGCTGACCGGATTGCCCACTGCGATCGTGGTGACGAACGAGGTCGGCCTCGGGGTGGTGCCATCCCATTCTTCGGGCGTGCTGTTTCGCGATCTACTGGGCACAATCAACCGACGCGTGGCAGCCGTCTGCGATGAGGTACATCTGGTCATCGCCGGACGTGTGCTCAAGCTGTG
- Drug Resistance
- Mutations
- Function
- Unknown
- Family
-
Unknown
- GO
-
- cobalamin biosynthetic process GO:0009236 biological_process
- GTP binding GO:0005525 molecular_function
- nucleotidyltransferase activity GO:0016779 molecular_function
- adenosylcobinamide kinase activity GO:0043752 molecular_function
- InterPro
Summary
- Name
- Probable bifunctional cobalamin biosynthesis protein CobU: cobinamide kinase + cobinamide phosphate guanylyltransferase
- Family
- Unknown
- Protein Sequence
-
MRILVTGGVRSGKSTHAEALLGDAADVVYVAPGRPAAGSDPDWDARVALHRARRPPTWLTVETADVATALSEARSPVLVDCLGTWLTAIMDGEALWSAATADVYAVLEARLDGLCAALTGLPTAIVVTNEVGLGVVPSHSSGVLFRDLLGTINRRVAAVCDEVHLVIAGRVLKL
- Mass
- 18,142 Da
- Length
- 174 Aa
Rv0254c doesn't seem to be a targeted by any drug.
-
-
Porphyrin and chlorophyll metabolism mtu00860
mtu00860PATHWAY_MAP mtu00860 Porphyrin and chlorophyll metabolism
-
- Proteogenomic analysis of Mycobacterium tuberculosis by high resolution mass spectrometry.
- Mol Cell Proteomics. 2011 Dec;10(12):M111.011627. doi: 10.1074/mcp.M111.011445. Epub 2011 Oct 3.
- Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence.
- Nature. 1998 Jun 11;393(6685):537-44. doi: 10.1038/31159.