groEL2
- Type
- protein_coding
- Name
- groEL2
- Locus Name
-
Rv0440
- Product
-
60 kDa chaperonin 2 GroEL2 (protein CPN60-2) (GroEL protein 2) (65 kDa antigen) (heat shock protein 65) (cell wall protein A) (antigen A)
- Functional Category
-
Virulence, detoxification, adaptation
- Location
- 528608..530230 (+ strand)
- Gene Length
- 1622 bp
- Nucleotides
-
TGGCCAAGACAATTGCGTACGACGAAGAGGCCCGTCGCGGCCTCGAGCGGGGCTTGAACGCCCTCGCCGATGCGGTAAAGGTGACATTGGGCCCCAAGGGCCGCAACGTCGTCCTGGAAAAGAAGTGGGGTGCCCCCACGATCACCAACGATGGTGTGTCCATCGCCAAGGAGATCGAGCTGGAGGATCCGTACGAGAAGATCGGCGCCGAGCTGGTCAAAGAGGTAGCCAAGAAGACCGATGACGTCGCCGGTGACGGCACCACGACGGCCACCGTGCTGGCCCAGGCGTTGGTTCGCGAGGGCCTGCGCAACGTCGCGGCCGGCGCCAACCCGCTCGGTCTCAAACGCGGCATCGAAAAGGCCGTGGAGAAGGTCACCGAGACCCTGCTCAAGGGCGCCAAGGAGGTCGAGACCAAGGAGCAGATTGCGGCCACCGCAGCGATTTCGGCGGGTGACCAGTCCATCGGTGACCTGATCGCCGAGGCGATGGACAAGGTGGGCAACGAGGGCGTCATCACCGTCGAGGAGTCCAACACCTTTGGGCTGCAGCTCGAGCTCACCGAGGGTATGCGGTTCGACAAGGGCTACATCTCGGGGTACTTCGTGACCGACCCGGAGCGTCAGGAGGCGGTCCTGGAGGACCCCTACATCCTGCTGGTCAGCTCCAAGGTGTCCACTGTCAAGGATCTGCTGCCGCTGCTCGAGAAGGTCATCGGAGCCGGTAAGCCGCTGCTGATCATCGCCGAGGACGTCGAGGGCGAGGCGCTGTCCACCCTGGTCGTCAACAAGATCCGCGGCACCTTCAAGTCGGTGGCGGTCAAGGCTCCCGGCTTCGGCGACCGCCGCAAGGCGATGCTGCAGGATATGGCCATTCTCACCGGTGGTCAGGTGATCAGCGAAGAGGTCGGCCTGACGCTGGAGAACGCCGACCTGTCGCTGCTAGGCAAGGCCCGCAAGGTCGTGGTCACCAAGGACGAGACCACCATCGTCGAGGGCGCCGGTGACACCGACGCCATCGCCGGACGAGTGGCCCAGATCCGCCAGGAGATCGAGAACAGCGACTCCGACTACGACCGTGAGAAGCTGCAGGAGCGGCTGGCCAAGCTGGCCGGTGGTGTCGCGGTGATCAAGGCCGGTGCCGCCACCGAGGTCGAACTCAAGGAGCGCAAGCACCGCATCGAGGATGCGGTTCGCAATGCCAAGGCCGCCGTCGAGGAGGGCATCGTCGCCGGTGGGGGTGTGACGCTGTTGCAAGCGGCCCCGACCCTGGACGAGCTGAAGCTCGAAGGCGACGAGGCGACCGGCGCCAACATCGTGAAGGTGGCGCTGGAGGCCCCGCTGAAGCAGATCGCCTTCAACTCCGGGCTGGAGCCGGGCGTGGTGGCCGAGAAGGTGCGCAACCTGCCGGCTGGCCACGGACTGAACGCTCAGACCGGTGTCTACGAGGATCTGCTCGCTGCCGGCGTTGCTGACCCGGTCAAGGTGACCCGTTCGGCGCTGCAGAATGCGGCGTCCATCGCGGGGCTGTTCCTGACCACCGAGGCCGTCGTTGCCGACAAGCCGGAAAAGGAGAAGGCTTCCGTTCCCGGTGGCGGCGACATGGGTGGCATGGATTTCTGA
- Drug Resistance
- Mutations
- Function
- Prevents aggregation of substrate proteins and promotes their refolding (PubMed:15327959). {ECO:0000269|PubMed:15327959}.; FUNCTION: Recombinant extracellular protein activates expression of NF-kappa-B in immortalized human dermal endothelial cells in a TLR4-dependent, TLR2-independent manner. Activation occurs via MYD88-dependent and -independent pathways and requires TIRAP, TRIF, TRAM and MD-2 (some experiments done in mouse cells, mice do not usually catch tuberculosis) (PubMed:15809303). {ECO:0000269|PubMed:15809303}.
- Family
-
Chaperonin (HSP60) family
- GO
-
- adhesion of symbiont to host GO:0044406 biological_process
- response to heat GO:0009408 biological_process
- positive regulation of transcription regulatory region DNA binding GO:2000679 biological_process
- protein refolding GO:0042026 biological_process
- cell wall GO:0005618 cellular_component
- capsule GO:0042603 cellular_component
- extracellular region GO:0005576 cellular_component
- ATP binding GO:0005524 molecular_function
- cytosol GO:0005829 cellular_component
- GroEL-GroES complex GO:1990220 cellular_component
- plasma membrane GO:0005886 cellular_component
- response to hypoxia GO:0001666 biological_process
- 'de novo' protein folding GO:0006458 biological_process
- unfolded protein binding GO:0051082 molecular_function
- InterPro
1SJP
- Name
- 60 kDa chaperonin 2 (65 kDa antigen) (Antigen A) (Cell wall protein A) (GroEL protein 2) (Heat shock protein 65) (Protein Cpn60-2)
- Family
- Chaperonin (HSP60) family
- Protein Sequence
-
MAKTIAYDEEARRGLERGLNALADAVKVTLGPKGRNVVLEKKWGAPTITNDGVSIAKEIELEDPYEKIGAELVKEVAKKTDDVAGDGTTTATVLAQALVREGLRNVAAGANPLGLKRGIEKAVEKVTETLLKGAKEVETKEQIAATAAISAGDQSIGDLIAEAMDKVGNEGVITVEESNTFGLQLELTEGMRFDKGYISGYFVTDPERQEAVLEDPYILLVSSKVSTVKDLLPLLEKVIGAGKPLLIIAEDVEGEALSTLVVNKIRGTFKSVAVKAPGFGDRRKAMLQDMAILTGGQVISEEVGLTLENADLSLLGKARKVVVTKDETTIVEGAGDTDAIAGRVAQIRQEIENSDSDYDREKLQERLAKLAGGVAVIKAGAATEVELKERKHRIEDAVRNAKAAVEEGIVAGGGVTLLQAAPTLDELKLEGDEATGANIVKVALEAPLKQIAFNSGLEPGVVAEKVRNLPAGHGLNAQTGVYEDLLAAGVADPVKVTRSALQNAASIAGLFLTTEAVVADKPEKEKASVPGGGDMGGMDF
- Mass
- 56,727 Da
- Length
- 540 Aa
Summary
Rv0440 doesn't seem to be a targeted by any drug.
-
-
Tuberculosis mtu05152
mtu05152Human Diseases; Infectious disease: bacterial
-
-
-
RNA degradation mtu03018
mtu03018Genetic Information Processing; Folding, sorting and degradation
-
- The dimeric structure of the Cpn60.2 chaperonin of Mycobacterium tuberculosis at 2.8 A reveals possible modes of function.
- J Mol Biol. 2011 Sep 16;412(2):192-203. doi: 10.1016/j.jmb.2011.07.026. Epub 2011 Jul 23.
- Crystal structure of the 65-kilodalton heat shock protein, chaperonin 60.2, of Mycobacterium tuberculosis.
- J Bacteriol. 2004 Dec;186(23):8105-13. doi: 10.1128/JB.186.23.8105-8113.2004.
- Mycobacterium tuberculosis WhiB1 represses transcription of the essential chaperonin GroEL2.
- Tuberculosis (Edinb). 2012 Jul;92(4):328-32. doi: 10.1016/j.tube.2012.03.001. Epub 2012 Mar 29.
- Proteogenomic analysis of Mycobacterium tuberculosis by high resolution mass spectrometry.
- Mol Cell Proteomics. 2011 Dec;10(12):M111.011627. doi: 10.1074/mcp.M111.011445. Epub 2011 Oct 3.
- Prokaryotic ubiquitin-like protein (Pup) proteome of Mycobacterium tuberculosis [corrected] .
- PLoS One. 2010 Jan 6;5(1):e8589. doi: 10.1371/journal.pone.0008589.
- A Mycobacterium tuberculosis mutant lacking the groEL homologue cpn60.1 is viable but fails to induce an inflammatory response in animal models of infection.
- Infect Immun. 2008 Apr;76(4):1535-46. doi: 10.1128/IAI.01078-07. Epub 2008 Jan 28.
- Mycobacterium tuberculosis heat shock proteins use diverse Toll-like receptor pathways to activate pro-inflammatory signals.
- J Biol Chem. 2005 Jun 3;280(22):20961-7. doi: 10.1074/jbc.M411379200. Epub 2005 Apr 4.
- Mycobacterium tuberculosis GroEL homologues unusually exist as lower oligomers and retain the ability to suppress aggregation of substrate proteins.
- J Mol Biol. 2004 Sep 10;342(2):605-17. doi: 10.1016/j.jmb.2004.07.066.
- [Detection and identification of mycobacteria by PCR-RFLP method].
- Rinsho Byori. 1995 Feb;43(2):155-61.
- Rapid Mycobacterium species assignment and unambiguous identification of mutations associated with antimicrobial resistance in Mycobacterium tuberculosis by automated DNA sequencing.
- Arch Pathol Lab Med. 1995 Feb;119(2):131-8.
- Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence.
- Nature. 1998 Jun 11;393(6685):537-44. doi: 10.1038/31159.
- The 65-kilodalton antigen of Mycobacterium tuberculosis.
- J Bacteriol. 1987 Mar;169(3):1080-8. doi: 10.1128/jb.169.3.1080-1088.1987.