regX3
- Type
- protein_coding
- Name
- regX3
- Locus Name
-
Rv0491
- Product
-
Two component sensory transduction protein RegX3 (transcriptional regulatory protein) (probably LuxR-family)
- Functional Category
-
Regulatory proteins
- Location
- 580809..581492 (+ strand)
- Gene Length
- 683 bp
- Nucleotides
-
TGACCAGTGTGTTGATTGTGGAGGACGAGGAGTCGCTGGCCGATCCGCTGGCGTTTCTGCTGCGCAAGGAGGGCTTTGAGGCCACGGTGGTGACCGATGGTCCGGCAGCTCTCGCCGAGTTCGACCGGGCCGGCGCCGACATCGTCCTGCTCGATCTGATGCTGCCTGGGATGTCGGGTACCGATGTATGCAAGCAGTTGCGCGCTCGGTCCAGCGTTCCGGTGATCATGGTGACCGCCCGGGATAGCGAGATCGACAAGGTGGTCGGCCTGGAGCTGGGCGCTGACGACTACGTGACCAAGCCCTATTCGGCACGCGAGTTGATCGCACGCATCCGCGCGGTGCTGCGCCGTGGCGGCGACGACGACTCGGAGATGAGCGATGGCGTGCTGGAGTCCGGGCCGGTTCGCATGGATGTGGAGCGCCATGTCGTCTCGGTGAACGGTGACACCATCACGCTGCCGCTCAAGGAGTTCGACCTGCTGGAATACCTGATGCGCAACAGCGGGCGGGTGTTGACTCGCGGACAACTGATCGACCGGGTCTGGGGTGCGGACTACGTGGGCGACACCAAGACGCTCGACGTCCATGTCAAGCGGCTGCGCTCCAAGATCGAAGCCGACCCGGCTAACCCGGTTCACTTGGTGACGGTGCGCGGGCTGGGCTACAAACTCGAGGGCTAG
- Drug Resistance
- Mutations
- Function
- Probably forms part of a two-component regulatory system regX3/senX3.
- Family
-
Unknown
- GO
-
- regulation of phosphate metabolic process GO:0019220 biological_process
- transcription regulatory region sequence-specific DNA binding GO:0000976 molecular_function
- pathogenesis GO:0009405 biological_process
- phosphorelay response regulator activity GO:0000156 molecular_function
- regulation of transcription, DNA-templated GO:0006355 biological_process
- DNA binding GO:0003677 molecular_function
- cytosol GO:0005829 cellular_component
- protein-DNA complex GO:0032993 cellular_component
- DNA-binding transcription activator activity GO:0001216 molecular_function
- DNA-binding transcription factor activity GO:0003700 molecular_function
- InterPro
2OQR
- Name
- Sensory transduction protein regX3
- Family
- Unknown
- Protein Sequence
-
MTSVLIVEDEESLADPLAFLLRKEGFEATVVTDGPAALAEFDRAGADIVLLDLMLPGMSGTDVCKQLRARSSVPVIMVTARDSEIDKVVGLELGADDYVTKPYSARELIARIRAVLRRGGDDDSEMSDGVLESGPVRMDVERHVVSVNGDTITLPLKEFDLLEYLMRNSGRVLTRGQLIDRVWGADYVGDTKTLDVHVKRLRSKIEADPANPVHLVTVRGLGYKLEG
- Mass
- 24,849 Da
- Length
- 227 Aa
Summary
Rv0491 doesn't seem to be a targeted by any drug.
-
-
Two-component system mtu02020
mtu02020Environmental Information Processing; Signal transduction
-
- Proteogenomic analysis of Mycobacterium tuberculosis by high resolution mass spectrometry.
- Mol Cell Proteomics. 2011 Dec;10(12):M111.011627. doi: 10.1074/mcp.M111.011445. Epub 2011 Oct 3.
- Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence.
- Nature. 1998 Jun 11;393(6685):537-44. doi: 10.1038/31159.
- Identification of novel intergenic repetitive units in a mycobacterial two-component system operon.
- Mol Microbiol. 1997 Dec;26(5):991-1003.