fabH
- Type
- protein_coding
- Name
- fabH
- Locus Name
-
Rv0533c
- Product
-
3-oxoacyl-[acyl-carrier-protein] synthase III FabH (beta-ketoacyl-ACP synthase III) (KAS III)
- Functional Category
-
Lipid metabolism
- Location
- 624473..625480 (- strand)
- Gene Length
- 1007 bp
- Nucleotides
-
ATGACGGAGATCGCCACGACCAGCGGCGCCAGGAGCGTCGGGCTGCTCAGTGTCGGGGCGTACCGGCCCGAACGCGTGGTCACCAACGACGAGATATGCCAGCACATCGACTCGTCCGACGAGTGGATCTACACCCGAACCGGCATCAAGACCCGCCGATTCGCCGCCGACGACGAGTCGGCGGCTTCCATGGCGACTGAGGCCTGTCGACGGGCACTGTCGAACGCCGGCCTGTCGGCGGCCGACATCGATGGCGTGATCGTCACCACCAACACCCATTTCCTGCAAACCCCGCCGGCCGCCCCAATGGTCGCGGCGTCGCTGGGCGCCAAGGGCATACTCGGGTTCGATCTTTCGGCGGGGTGCGCCGGATTCGGATATGCGCTTGGCGCAGCGGCCGACATGATCCGGGGCGGAGGTGCGGCCACGATGCTGGTGGTCGGCACGGAAAAACTGTCCCCCACGATAGACATGTACGACCGCGGCAACTGCTTCATCTTCGCCGACGGCGCGGCCGCAGTGGTGGTGGGCGAGACACCGTTTCAAGGCATTGGACCAACCGTGGCGGGTAGCGACGGCGAACAGGCCGATGCCATACGGCAGGACATCGACTGGATCACTTTCGCCCAGAATCCCAGCGGCCCACGCCCGTTTGTGCGGCTCGAAGGTCCCGCGGTCTTCCGTTGGGCAGCGTTCAAAATGGGCGACGTCGGTCGGCGCGCGATGGACGCCGCCGGGGTGCGACCCGACCAGATAGACGTGTTCGTCCCTCATCAGGCCAATAGCCGCATCAACGAGCTGCTGGTCAAGAACCTGCAGTTGCGGCCCGACGCGGTGGTCGCCAACGATATCGAGCACACCGGAAACACCTCGGCGGCCTCCATTCCGCTCGCGATGGCCGAATTACTGACGACCGGCGCGGCCAAGCCCGGCGATCTGGCCCTGTTGATCGGCTACGGCGCCGGTCTGAGCTATGCCGCCCAGGTGGTGCGAATGCCGAAGGGTTG
- Drug Resistance
- Mutations
- Function
- Catalyzes the condensation reaction of fatty acid synthesis by the addition to an acyl acceptor of two carbons from malonyl-ACP. Catalyzes the first condensation reaction which initiates fatty acid synthesis and may therefore play a role in governing the total rate of fatty acid production. Possesses both acetoacetyl-ACP synthase and acetyl transacylase activities. Has some substrate specificity for long chain acyl-CoA such as myristoyl-CoA. Does not use acyl-CoA as primer. Its substrate specificity determines the biosynthesis of mycolic acid fatty acid chain, which is characteristic of mycobacterial cell wall. {ECO:0000269|PubMed:10840036}.
- Family
-
Thiolase-like superfamily, FabH family
- GO
-
- lipid biosynthetic process GO:0008610 biological_process
- fatty acid elongation GO:0030497 biological_process
- cytoplasm GO:0005737 cellular_component
- long-chain fatty-acyl-CoA metabolic process GO:0035336 biological_process
- beta-ketoacyl-acyl-carrier-protein synthase III activity GO:0033818 molecular_function
- 3-oxoacyl-[acyl-carrier-protein] synthase activity GO:0004315 molecular_function
- fatty-acyl-CoA binding GO:0000062 molecular_function
- fatty acid biosynthetic process GO:0006633 biological_process
- InterPro
1HZP
- Name
- 3-oxoacyl-[acyl-carrier-protein] synthase 3 (EC 2.3.1.180) (3-oxoacyl-[acyl-carrier-protein] synthase III) (Beta-ketoacyl-ACP synthase III) (KAS III) (MtFabH)
- Family
- Thiolase-like superfamily, FabH family
- Protein Sequence
-
MTEIATTSGARSVGLLSVGAYRPERVVTNDEICQHIDSSDEWIYTRTGIKTRRFAADDESAASMATEACRRALSNAGLSAADIDGVIVTTNTHFLQTPPAAPMVAASLGAKGILGFDLSAGCAGFGYALGAAADMIRGGGAATMLVVGTEKLSPTIDMYDRGNCFIFADGAAAVVVGETPFQGIGPTVAGSDGEQADAIRQDIDWITFAQNPSGPRPFVRLEGPAVFRWAAFKMGDVGRRAMDAAGVRPDQIDVFVPHQANSRINELLVKNLQLRPDAVVANDIEHTGNTSAASIPLAMAELLTTGAAKPGDLALLIGYGAGLSYAAQVVRMPKG
- Mass
- 34,873 Da
- Length
- 335 Aa
Summary
- Lauric Acid DB03017
-
1-Undecanecarboxylic acid | ABL | C12 fatty acid | C12:0 | Coconut oil fatty acids | DAO | Dodecanoate | Dodecanoic acid | Dodecoic acid | Dodecylcarboxylate | Dodecylic acid | Duodecyclic acid | Duodecylic acid | Laurinsäure | Laurostearic acid | N-dodecanoate | N-dodecanoic acid | Undecane-1-carboxylic acid | Vulvic acid
Rv0533c doesn't seem to be involved in any pathway.
- Crystal structure of the Mycobacterium tuberculosis beta-ketoacyl-acyl carrier protein synthase III.
- J Biol Chem. 2001 Jun 8;276(23):20516-22. doi: 10.1074/jbc.M010762200. Epub 2001 Mar 8.
- Proteogenomic analysis of Mycobacterium tuberculosis by high resolution mass spectrometry.
- Mol Cell Proteomics. 2011 Dec;10(12):M111.011627. doi: 10.1074/mcp.M111.011445. Epub 2011 Oct 3.
- targetTB: a target identification pipeline for Mycobacterium tuberculosis through an interactome, reactome and genome-scale structural analysis.
- BMC Syst Biol. 2008 Dec 19;2:109. doi: 10.1186/1752-0509-2-109.
- Identification and substrate specificity of beta -ketoacyl (acyl carrier protein) synthase III (mtFabH) from Mycobacterium tuberculosis.
- J Biol Chem. 2000 Sep 8;275(36):28201-7. doi: 10.1074/jbc.M003241200.
- Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence.
- Nature. 1998 Jun 11;393(6685):537-44. doi: 10.1038/31159.