Gene - combatTB X

Type: protein_coding
Name: mce2R
Locus Name: Rv0586
Product: Probable transcriptional regulatory protein Mce2R (GntR-family)
Functional Category: Regulatory proteins
Location: 684410..685132 (+ strand)
Gene Length: 722 bp
Nucleotides: TGGCGCTGCAGCCGGTGACTCGCCGATCGGTGCCCGAAGAGGTCTTCGAGCAGATCGCTACCGATGTGCTCACCGGCGAGATGCCGCCCGGCGAGGCGTTGCCCAGCGAGCGTCGGTTGGCTGAGTTGCTCGGAGTGTCGCGACCCGCGGTCCGCGAGGCGCTCAAACGGCTGTCGGCCGCAGGTCTGGTCGAGGTGCGTCAGGGCGACGTCACCACCGTGCGTGACTTCCGGCGGCACGCCGGCCTGGATCTGTTGCCCCGATTGTTGTTTCGCAACGGTGAGCTGGATATCTCCGTCGTCCGCAGCATCCTCGAGGCCCGGCTGCGCAATTTTCCGAAGGTCGCGGAACTAGCGGCCGAACGGAACGAGCCCGAGTTGGCGGAATTGCTGCAGGATTCGCTGCGTGCGCTGGACACTGAGGAAGATCCGATCGTGTGGCAACGCCACACGCTCGACTTTTGGGATCATGTGGTCGACAGCGCCGGTTCGATCGTAGATCGATTGATGTACAACGCATTTCGTGCTGCTTACGAGCCGACGCTAGCTGCTCTGACCACCACGATGACCGCTGCGGCTAAGCGTCCGTCGGACTACCGGAAACTCGCGGATGCGATCTGCTCAGGTGATCCCACCGGAGCGAAGAAAGCCGCCCAAGACCTACTCGAACTTGCGAACACATCGTTGATGGCCGTACTCGTTAGCCAGGCGAGTCGGCAATGA
Drug Resistance: Check for drug resistance association at TBDREAMDB
Mutations: Check for mutants available at TARGET

Function

Negatively regulates the expression of its operon as well as expression of end (endonuclease 4). {ECO:0000269|PubMed:19027363}.

Family

Unknown

GO

DNA-binding transcription factor activity GO:0003700 molecular_function
protein-DNA complex GO:0032993 cellular_component
DNA binding GO:0003677 molecular_function
response to host immune response GO:0052572 biological_process
negative regulation of transcription, DNA-templated GO:0045892 biological_process
sequence-specific DNA binding GO:0043565 molecular_function

InterPro

Summary

Name: HTH-type transcriptional regulator Mce2R
Family: Unknown
Protein Sequence: MALQPVTRRSVPEEVFEQIATDVLTGEMPPGEALPSERRLAELLGVSRPAVREALKRLSAAGLVEVRQGDVTTVRDFRRHAGLDLLPRLLFRNGELDISVVRSILEARLRNFPKVAELAAERNEPELAELLQDSLRALDTEEDPIVWQRHTLDFWDHVVDSAGSIVDRLMYNAFRAAYEPTLAALTTTMTAAAKRPSDYRKLADAICSGDPTGAKKAAQDLLELANTSLMAVLVSQASRQ
Mass: 26,509 Da
Length: 240 Aa

Rv0586 doesn't seem to be a targeted by any drug.

Rv0586 doesn't seem to be involved in any pathway.

Proteogenomic analysis of Mycobacterium tuberculosis by high resolution mass spectrometry.: Mol Cell Proteomics. 2011 Dec;10(12):M111.011627. doi: 10.1074/mcp.M111.011445. Epub 2011 Oct 3.
Mce2R from Mycobacterium tuberculosis represses the expression of the mce2 operon.: Tuberculosis (Edinb). 2009 Jan;89(1):22-8. doi: 10.1016/j.tube.2008.09.002. Epub 2008 Nov 22.
Identification of operator sites within the upstream region of the putative mce2R gene from mycobacteria.: FEBS Lett. 2008 Apr 2;582(7):1117-22. doi: 10.1016/j.febslet.2008.02.074. Epub 2008 Mar 7.
targetTB: a target identification pipeline for Mycobacterium tuberculosis through an interactome, reactome and genome-scale structural analysis.: BMC Syst Biol. 2008 Dec 19;2:109. doi: 10.1186/1752-0509-2-109.
Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence.: Nature. 1998 Jun 11;393(6685):537-44. doi: 10.1038/31159.