rpsH
- Type
- protein_coding
- Name
- rpsH
- Locus Name
-
Rv0718
- Product
-
30S ribosomal protein S8 RpsH
- Functional Category
-
Information pathways
- Location
- 812976..813374 (+ strand)
- Gene Length
- 398 bp
- Nucleotides
-
TGACGATGACGGACCCGATCGCAGACTTTTTGACCCGTCTGCGTAACGCCAACTCGGCGTATCACGACGAGGTCAGCTTGCCGCACTCCAAGCTCAAGGCCAACATCGCGCAGATTCTCAAGAACGAGGGGTACATCAGCGACTTCCGAACCGAGGACGCTCGGGTCGGTAAATCGCTGGTTATCCAGCTCAAGTACGGCCCTAGCCGGGAGCGCAGCATCGCCGGGTTGCGGCGGGTGTCCAAGCCCGGCCTGCGGGTGTACGCGAAATCCACCAATCTGCCGCGGGTGCTCGGCGGCCTGGGCGTGGCGATCATCTCGACCTCCTCGGGCCTGCTGACTGACCGGCAGGCAGCTAGACAGGGCGTGGGCGGCGAAGTCCTCGCATATGTCTGGTGA
- Drug Resistance
- Mutations
- Function
- One of the primary rRNA binding proteins, it binds directly to 16S rRNA central domain where it helps coordinate assembly of the platform of the 30S subunit. {ECO:0000255|HAMAP-Rule:MF_01302}.
- Family
-
Universal ribosomal protein uS8 family
- GO
-
- cytosolic small ribosomal subunit GO:0022627 cellular_component
- structural constituent of ribosome GO:0003735 molecular_function
- rRNA binding GO:0019843 molecular_function
- translation GO:0006412 biological_process
- InterPro
Summary
- Name
- 30S ribosomal protein S8
- Family
- Universal ribosomal protein uS8 family
- Protein Sequence
-
MTMTDPIADFLTRLRNANSAYHDEVSLPHSKLKANIAQILKNEGYISDFRTEDARVGKSLVIQLKYGPSRERSIAGLRRVSKPGLRVYAKSTNLPRVLGGLGVAIISTSSGLLTDRQAARQGVGGEVLAYVW
- Mass
- 14,412 Da
- Length
- 132 Aa
Rv0718 doesn't seem to be a targeted by any drug.
-
-
Ribosome mtu03010
mtu03010PATHWAY_MAP mtu03010 Ribosome
-
- Proteogenomic analysis of Mycobacterium tuberculosis by high resolution mass spectrometry.
- Mol Cell Proteomics. 2011 Dec;10(12):M111.011627. doi: 10.1074/mcp.M111.011445. Epub 2011 Oct 3.
- Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence.
- Nature. 1998 Jun 11;393(6685):537-44. doi: 10.1038/31159.