mapA
- Type
- protein_coding
- Name
- mapA
- Locus Name
-
Rv0734
- Product
-
Methionine aminopeptidase MapA (map) (peptidase M) (MetAP)
- Functional Category
-
Intermediary metabolism and respiration
- Location
- 826670..827470 (+ strand)
- Gene Length
- 800 bp
- Nucleotides
-
TGCGCCCACTGGCACGGCTGCGGGGTCGCAGGGTCGTGCCGCAGCGCAGTGCCGGCGAACTCGACGCGATGGCCGCGGCGGGCGCCGTCGTTGCCGCCGCGCTGCGGGCGATCCGTGCGGCAGCGGCTCCCGGCACATCCAGCCTGAGTCTCGACGAGATCGCCGAGTCGGTGATCCGCGAATCCGGCGCCACCCCGTCGTTTCTGGGCTATCACGGCTACCCGGCCTCGATCTGCGCGTCGATCAACGACCGGGTGGTTCATGGCATCCCGTCGACCGCCGAGGTGCTCGCGCCCGGTGATCTGGTATCCATCGACTGCGGTGCGGTGCTGGACGGTTGGCATGGCGATGCGGCGATCACTTTCGGGGTTGGCGCCCTGAGCGACGCCGACGAAGCGCTGTCGGAGGCGACAAGGGAATCGCTTCAGGCCGGCATCGCCGCGATGGTGGTCGGCAATCGGTTGACCGACGTCGCGCATGCCATCGAAACGGGTACCCGTGCCGCCGAGCTCCGTTATGGACGCTCGTTCGGGATCGTCGCCGGTTACGGGGGCCACGGCATCGGCCGCCAGATGCATATGGATCCGTTCTTGCCGAACGAGGGTGCGCCGGGGCGCGGTCCGCTGCTGGCTGCCGGCTCGGTGCTGGCCATCGAACCGATGCTGACCCTCGGTACCACCAAAACGGTGGTGCTCGACGACAAATGGACGGTCACGACCGCCGATGGGTCACGTGCGGCACACTGGGAACACACCGTGGCGGTAACCGACGACGGGCCCCGAATTCTGACGCTCGGTTAG
- Drug Resistance
- Mutations
- Function
- Removes the N-terminal methionine from nascent proteins. The N-terminal methionine is often cleaved when the second residue in the primary sequence is small and uncharged (Met-Ala-, Cys, Gly, Pro, Ser, Thr, or Val). Requires deformylation of the N(alpha)-formylated initiator methionine before it can be hydrolyzed. {ECO:0000255|HAMAP-Rule:MF_01974, ECO:0000269|PubMed:19688379}.
- Family
-
Peptidase M24A family, Methionine aminopeptidase type 1 subfamily
- GO
-
- manganese ion binding GO:0030145 molecular_function
- iron ion binding GO:0005506 molecular_function
- plasma membrane GO:0005886 cellular_component
- cobalt ion binding GO:0050897 molecular_function
- metalloaminopeptidase activity GO:0070006 molecular_function
- protein initiator methionine removal involved in protein maturation GO:0035551 biological_process
- nickel cation binding GO:0016151 molecular_function
- methionine metabolic process GO:0006555 biological_process
- InterPro
Summary
- Name
- Methionine aminopeptidase 1 (MAP 1) (MetAP 1) (EC 3.4.11.18) (Peptidase M)
- Family
- Peptidase M24A family, Methionine aminopeptidase type 1 subfamily
- Protein Sequence
-
MRPLARLRGRRVVPQRSAGELDAMAAAGAVVAAALRAIRAAAAPGTSSLSLDEIAESVIRESGATPSFLGYHGYPASICASINDRVVHGIPSTAEVLAPGDLVSIDCGAVLDGWHGDAAITFGVGALSDADEALSEATRESLQAGIAAMVVGNRLTDVAHAIETGTRAAELRYGRSFGIVAGYGGHGIGRQMHMDPFLPNEGAPGRGPLLAAGSVLAIEPMLTLGTTKTVVLDDKWTVTTADGSRAAHWEHTVAVTDDGPRILTLG
- Mass
- 27,277 Da
- Length
- 266 Aa
Rv0734 doesn't seem to be a targeted by any drug.
Rv0734 doesn't seem to be involved in any pathway.
- Proteogenomic analysis of Mycobacterium tuberculosis by high resolution mass spectrometry.
- Mol Cell Proteomics. 2011 Dec;10(12):M111.011627. doi: 10.1074/mcp.M111.011445. Epub 2011 Oct 3.
- Expression and characterization of Mycobacterium tuberculosis methionine aminopeptidase type 1a.
- Bioorg Med Chem Lett. 2010 May 1;20(9):2776-9. doi: 10.1016/j.bmcl.2010.03.067. Epub 2010 Mar 19.
- Expression and characterization of two functional methionine aminopeptidases from Mycobacterium tuberculosis H37Rv.
- Curr Microbiol. 2009 Nov;59(5):520-5. doi: 10.1007/s00284-009-9470-3. Epub 2009 Aug 18.
- Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence.
- Nature. 1998 Jun 11;393(6685):537-44. doi: 10.1038/31159.