phoP
- Type
- protein_coding
- Name
- phoP
- Locus Name
-
Rv0757
- Product
-
Possible two component system response transcriptional positive regulator PhoP
- Functional Category
-
Regulatory proteins
- Location
- 851608..852351 (+ strand)
- Gene Length
- 743 bp
- Nucleotides
-
TGCGGAAAGGGGTTGATCTCGTGACGGCGGGAACCCCAGGCGAAAACACCACACCGGAGGCTCGTGTCCTCGTGGTCGATGATGAGGCCAACATCGTTGAACTGCTGTCGGTGAGCCTCAAGTTCCAGGGCTTTGAAGTCTACACCGCGACCAACGGGGCACAGGCGCTGGATCGGGCCCGGGAAACCCGGCCGGACGCGGTGATCCTCGATGTGATGATGCCCGGGATGGACGGCTTTGGGGTGCTGCGCCGGCTGCGCGCCGACGGCATCGATGCCCCGGCGTTGTTCCTGACGGCCCGTGACTCGCTACAGGACAAGATCGCGGGTCTGACCCTGGGTGGTGACGACTATGTGACAAAGCCCTTCAGTTTGGAGGAGGTCGTGGCCAGGCTGCGGGTCATCCTGCGACGCGCGGGCAAGGGCAACAAGGAACCACGTAATGTTCGACTGACGTTCGCCGATATCGAGCTCGACGAGGAGACCCACGAAGTGTGGAAGGCGGGCCAACCGGTGTCGCTGTCGCCCACCGAATTCACCCTGCTGCGCTATTTCGTGATCAACGCGGGCACCGTGCTGAGCAAGCCTAAGATTCTCGACCACGTTTGGCGCTACGACTTCGGTGGTGATGTCAACGTCGTCGAGTCCTACGTGTCGTATCTGCGCCGCAAGATCGACACTGGGGAGAAGCGGCTGCTGCACACGCTGCGCGGGGTGGGCTACGTACTGCGGGAGCCTCGATGA
- Drug Resistance
- Mutations
- Function
- Unknown
- Family
-
Unknown
- GO
-
- protein secretion by the type VII secretion system GO:0044315 biological_process
- positive regulation of lipid biosynthetic process GO:0046889 biological_process
- metal ion binding GO:0046872 molecular_function
- positive regulation of gene expression GO:0010628 biological_process
- transcription regulatory region sequence-specific DNA binding GO:0000976 molecular_function
- pathogenesis GO:0009405 biological_process
- glycolipid biosynthetic process GO:0009247 biological_process
- DNA-binding transcription factor activity GO:0003700 molecular_function
- DNA-binding transcription activator activity GO:0001216 molecular_function
- protein-DNA complex GO:0032993 cellular_component
- cytosol GO:0005829 cellular_component
- positive regulation of transcription, DNA-templated GO:0045893 biological_process
- negative regulation of transcription, DNA-templated GO:0045892 biological_process
- plasma membrane GO:0005886 cellular_component
- phosphorelay response regulator activity GO:0000156 molecular_function
- response to oxidative stress GO:0006979 biological_process
- InterPro
3R0J
- Name
- Possible two component system response transcriptional positive regulator PhoP
- Family
- Unknown
- Protein Sequence
-
MRKGVDLVTAGTPGENTTPEARVLVVDDEANIVELLSVSLKFQGFEVYTATNGAQALDRARETRPDAVILDVMMPGMDGFGVLRRLRADGIDAPALFLTARDSLQDKIAGLTLGGDDYVTKPFSLEEVVARLRVILRRAGKGNKEPRNVRLTFADIELDEETHEVWKAGQPVSLSPTEFTLLRYFVINAGTVLSKPKILDHVWRYDFGGDVNVVESYVSYLRRKIDTGEKRLLHTLRGVGYVLREPR
- Mass
- 27,514 Da
- Length
- 247 Aa
Summary
Rv0757 doesn't seem to be a targeted by any drug.
Rv0757 doesn't seem to be involved in any pathway.
- Structural basis of DNA sequence recognition by the response regulator PhoP in Mycobacterium tuberculosis.
- Sci Rep. 2016 Apr 15;6:24442. doi: 10.1038/srep24442.
- Proteogenomic analysis of Mycobacterium tuberculosis by high resolution mass spectrometry.
- Mol Cell Proteomics. 2011 Dec;10(12):M111.011627. doi: 10.1074/mcp.M111.011445. Epub 2011 Oct 3.
- Structure of the response regulator PhoP from Mycobacterium tuberculosis reveals a dimer through the receiver domain.
- Biochemistry. 2011 Jul 5;50(26):5948-57. doi: 10.1021/bi2005575. Epub 2011 Jun 13.
- Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence.
- Nature. 1998 Jun 11;393(6685):537-44. doi: 10.1038/31159.