Rv0813c
- Type
- protein_coding
- Name
- Rv0813c
- Locus Name
-
Rv0813c
- Product
-
Conserved protein
- Functional Category
-
Conserved hypotheticals
- Location
- 907338..908018 (- strand)
- Gene Length
- 680 bp
- Nucleotides
-
GTGAGTTCCGGCGCGGGCTCGGATGCGACCGGGGCCGGCGGCGTCCATGCTGCGGGCTCCGGCGACCGTGCGGTCGCCGCTGCCGTCGAGCGGGCCAAGGCGACCGCCGCGCGCAATATCCCTGCCTTCGACGATTTGCCGGTTCCCGCAGATACCGCAAACCTGCGCGAAGGTGCCGACCTGAACAATGCACTGCTGGCGCTGCTGCCACTGGTCGGCGTGTGGCGCGGCGAAGGCGAGGGCCGCGGACCCGACGGCGACTACCGGTTCGGCCAGCAGATCGTTGTGTCACACGACGGCGGCGACTATCTGAATTGGGAATCCCGGTCCTGGCGGCTCACCGCCACGGGCGACTACCAGGAACCAGGCTTACGAGAAGCGGGATTCTGGCGGTTCGTCGCCGACCCGTACGATCCGAGCGAGTCTCAGGCGATCGAGTTGCTATTGGCGCATTCGGCCGGTTATGTCGAACTGTTCTACGGGCGGCCGCGCACCCAGTCCTCGTGGGAGTTGGTGACCGATGCGCTGGCCCGCAGTCGGTCTGGCGTTCTGGTCGGCGGCGCCAAACGACTCTACGGCATCGTCGAAGGTGGCGACCTGGCCTACGTCGAGGAACGCGTCGATGCCGACGGCGGGCTGGTACCACATCTGTCGGCGCGGTTGTCCCGGTTCGTCGGATA
- Drug Resistance
- Mutations
- Function
- May play a role in the intracellular transport of hydrophobic ligands. {ECO:0000305}.
- Family
-
UPF0678 family
- GO
-
- intracellular transport GO:0046907 biological_process
- plasma membrane GO:0005886 cellular_component
- InterPro
2FWV
- Name
- UPF0678 fatty acid-binding protein-like protein Rv0813c
- Family
- UPF0678 family
- Protein Sequence
-
MSSGAGSDATGAGGVHAAGSGDRAVAAAVERAKATAARNIPAFDDLPVPADTANLREGADLNNALLALLPLVGVWRGEGEGRGPDGDYRFGQQIVVSHDGGDYLNWESRSWRLTATGDYQEPGLREAGFWRFVADPYDPSESQAIELLLAHSAGYVELFYGRPRTQSSWELVTDALARSRSGVLVGGAKRLYGIVEGGDLAYVEERVDADGGLVPHLSARLSRFVG
- Mass
- 23,900 Da
- Length
- 226 Aa
Summary
Rv0813c doesn't seem to be a targeted by any drug.
Rv0813c doesn't seem to be involved in any pathway.
- The crystal structure of Rv0813c from Mycobacterium tuberculosis reveals a new family of fatty acid-binding protein-like proteins in bacteria.
- J Bacteriol. 2007 Mar;189(5):1899-904. doi: 10.1128/JB.01435-06. Epub 2006 Dec 15.
- Proteogenomic analysis of Mycobacterium tuberculosis by high resolution mass spectrometry.
- Mol Cell Proteomics. 2011 Dec;10(12):M111.011627. doi: 10.1074/mcp.M111.011445. Epub 2011 Oct 3.
- targetTB: a target identification pipeline for Mycobacterium tuberculosis through an interactome, reactome and genome-scale structural analysis.
- BMC Syst Biol. 2008 Dec 19;2:109. doi: 10.1186/1752-0509-2-109.
- Re-annotation of the genome sequence of Mycobacterium tuberculosis H37Rv.
- Microbiology. 2002 Oct;148(Pt 10):2967-73. doi: 10.1099/00221287-148-10-2967.
- Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence.
- Nature. 1998 Jun 11;393(6685):537-44. doi: 10.1038/31159.