narL
- Type
- protein_coding
- Name
- narL
- Locus Name
-
Rv0844c
- Product
-
Possible nitrate/nitrite response transcriptional regulatory protein NarL
- Functional Category
-
Regulatory proteins
- Location
- 940456..941106 (- strand)
- Gene Length
- 650 bp
- Nucleotides
-
ATGAGCAATCCGCAGCCGGAGAAAGTGCGCGTGGTGGTCGGCGACGACCACCCGTTATTTCGCGAGGGCGTTGTGCGAGCGCTTTCGTTGAGTGGCTCGGTGAACGTGGTCGGCGAGGCCGACGACGGCGCCGCGGCCCTGGAGTTGATCAAGGCCCATTTGCCCGACGTCGCATTGCTGGACTACCGCATGCCCGGCATGGACGGCGCGCAGGTTGCGGCGGCGGTGCGCAGCTACGAGTTGCCAACCCGGGTGCTGCTTATTTCCGCGCACGACGAGCCGGCGATCGTCTACCAGGCACTCCAACAGGGCGCCGCCGGATTCCTGCTCAAGGATTCGACTCGCACCGAGATCGTCAAGGCGGTGCTCGATTGCGCGAAGGGCCGCGACGTGGTGGCGCCCTCGCTGGTCGGGGGCCTCGCCGGGGAGATTCGCCAGCGCGCGGCACCCGTGGCCCCGGTGCTCAGCGCGCGCGAGCGCGAGGTGCTCAATCGCATTGCGTGCGGTCAAAGCATCCCCGCGATCGCAGCCGAGCTATATGTGGCGCCGTCGACGGTAAAGACCCACGTGCAACGGTTGTACGAGAAGCTCGGCGTCAGCGACCGAGCTGCCGCGGTCGCCGAGGCGATGCGGCAGAGGCTGCTCGACTA
- Drug Resistance
- Mutations
- Function
- Probable member of the two-component regulatory system NarS/NarL. {ECO:0000269|PubMed:12595424}.
- Family
-
Unknown
- GO
-
- DNA binding GO:0003677 molecular_function
- regulation of transcription, DNA-templated GO:0006355 biological_process
- cytoplasm GO:0005737 cellular_component
- phosphorelay signal transduction system GO:0000160 biological_process
- InterPro
3EUL
- Name
- Probable transcriptional regulatory protein NarL
- Family
- Unknown
- Protein Sequence
-
MSNPQPEKVRVVVGDDHPLFREGVVRALSLSGSVNVVGEADDGAAALELIKAHLPDVALLDYRMPGMDGAQVAAAVRSYELPTRVLLISAHDEPAIVYQALQQGAAGFLLKDSTRTEIVKAVLDCAKGRDVVAPSLVGGLAGEIRQRAAPVAPVLSAREREVLNRIACGQSIPAIAAELYVAPSTVKTHVQRLYEKLGVSDRAAAVAEAMRQRLLD
- Mass
- 22,916 Da
- Length
- 216 Aa
Summary
Rv0844c doesn't seem to be a targeted by any drug.
-
-
Two-component system mtu02020
mtu02020Environmental Information Processing; Signal transduction
-
- 1.9 A structure of the signal receiver domain of the putative response regulator NarL from Mycobacterium tuberculosis.
- Acta Crystallogr Sect F Struct Biol Cryst Commun. 2008 Dec 1;64(Pt 12):1096-100. doi: 10.1107/S1744309108035203. Epub 2008 Nov 28.
- Proteogenomic analysis of Mycobacterium tuberculosis by high resolution mass spectrometry.
- Mol Cell Proteomics. 2011 Dec;10(12):M111.011627. doi: 10.1074/mcp.M111.011445. Epub 2011 Oct 3.
- targetTB: a target identification pipeline for Mycobacterium tuberculosis through an interactome, reactome and genome-scale structural analysis.
- BMC Syst Biol. 2008 Dec 19;2:109. doi: 10.1186/1752-0509-2-109.
- Deletion of two-component regulatory systems increases the virulence of Mycobacterium tuberculosis.
- Infect Immun. 2003 Mar;71(3):1134-40. doi: 10.1128/iai.71.3.1134-1140.2003.
- Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence.
- Nature. 1998 Jun 11;393(6685):537-44. doi: 10.1038/31159.