ompA
- Type
- protein_coding
- Name
- ompA
- Locus Name
-
Rv0899
- Product
-
Outer membrane protein A OmpA
- Functional Category
-
Cell wall and cell processes
- Location
- 1002812..1003792 (+ strand)
- Gene Length
- 980 bp
- Nucleotides
-
TGGCTTCTAAGGCGGGTTTGGGCCAAACACCCGCGACCACCGACGCGCGACGAACTCAGAAATTCTACCGGGGCTCGCCGGGCCGTCCGTGGCTGATTGGCGCGGTGGTTATTCCGTTGCTGATAGCGGCAATCGGTTACGGTGCATTCGAGCGGCCCCAGTCCGTTACCGGACCGACCGGTGTGTTGCCGACACTGACACCGACCAGCACCCGGGGCGCTTCTGCGTTGTCCTTGTCTTTGCTGTCAATTAGCCGCAGCGGCAACACCGTTACTCTGATCGGTGACTTCCCCGATGAGGCCGCCAAGGCGGCCTTGATGACGGCGCTCAACGGCTTGCTTGCTCCGGGCGTGAACGTCATCGACCAGATTCACGTCGATCCCGTTGTGCGATCACTTGATTTCTCAAGTGCGGAACCAGTTTTCACCGCCAGCGTGCCGATTCCTGATTTTGGCCTCAAAGTCGAAAGGGACACCGTCACCTTGACCGGAACTGCCCCTTCATCCGAGCACAAGGACGCAGTGAAGCGCGCGGCGACCAGCACCTGGCCTGACATGAAAATCGTTAACAATATTGAGGTTACGGGGCAGGCACCGCCAGGACCCCCGGCCTCCGGCCCATGTGCCGACCTGCAATCAGCCATCAATGCCGTGACGGGTGGACCCATCGCGTTTGGCAACGACGGGGCTAGTCTGATCCCAGCCGACTATGAAATCCTGAACCGGGTAGCCGACAAGCTCAAGGCATGTCCGGACGCTCGGGTGACGATCAACGGCTACACCGACAACACCGGCAGCGAAGGTATCAATATCCCGTTGAGCGCTCAGCGAGCCAAGATAGTCGCCGACTACCTGGTTGCCCGCGGAGTTGCCGGCGATCACATTGCCACCGTGGGTCTCGGTTCGGTGAATCCGATCGCCAGCAACGCCACACCCGAGGGGCGCGCCAAGAATCGTCGCGTCGAGATCGTGGTCAACTAA
- Drug Resistance
- Mutations
- Function
- Probably plays a role in ammonia secretion that neutralizes the medium at pH 5.5, although it does not play a direct role in ammonia transport. The OmpA-like domain (196-326) binds M.tuberculosis peptidoglycan. Overexpression in M.bovis or M.smegmatis gives channels with average conductance value of 1,600 +/- 100 pS, but this may not be physiologically relevant. {ECO:0000269|PubMed:12366842, ECO:0000269|PubMed:17573469, ECO:0000269|PubMed:21410778}.
- Family
-
Outer membrane OOP (TC 1.B.6) superfamily, ArfA family
- GO
-
- metal ion binding GO:0046872 molecular_function
- response to acidic pH GO:0010447 biological_process
- growth of symbiont in host organelle GO:0044121 biological_process
- ammonium transmembrane transport GO:0072488 biological_process
- peptidoglycan binding GO:0042834 molecular_function
- integral component of plasma membrane GO:0005887 cellular_component
- porin activity GO:0015288 molecular_function
- cytosol GO:0005829 cellular_component
- extracellular region GO:0005576 cellular_component
- cell wall GO:0005618 cellular_component
- cell outer membrane GO:0009279 cellular_component
- InterPro
2KGS
- Name
- Peptidoglycan-binding protein ArfA (Outer membrane porin A) (Outer membrane protein A) (OmpATb) (Outer membrane protein ArfA)
- Family
- Outer membrane OOP (TC 1.B.6) superfamily, ArfA family
- Protein Sequence
-
MASKAGLGQTPATTDARRTQKFYRGSPGRPWLIGAVVIPLLIAAIGYGAFERPQSVTGPTGVLPTLTPTSTRGASALSLSLLSISRSGNTVTLIGDFPDEAAKAALMTALNGLLAPGVNVIDQIHVDPVVRSLDFSSAEPVFTASVPIPDFGLKVERDTVTLTGTAPSSEHKDAVKRAATSTWPDMKIVNNIEVTGQAPPGPPASGPCADLQSAINAVTGGPIAFGNDGASLIPADYEILNRVADKLKACPDARVTINGYTDNTGSEGINIPLSAQRAKIVADYLVARGVAGDHIATVGLGSVNPIASNATPEGRAKNRRVEIVVN
- Mass
- 33,574 Da
- Length
- 326 Aa
Summary
Rv0899 doesn't seem to be a targeted by any drug.
Rv0899 doesn't seem to be involved in any pathway.
- Structure of the Mycobacterium tuberculosis OmpATb protein: a model of an oligomeric channel in the mycobacterial cell wall.
- Proteins. 2011 Feb;79(2):645-61. doi: 10.1002/prot.22912.
- Molecular structure and peptidoglycan recognition of Mycobacterium tuberculosis ArfA (Rv0899).
- J Mol Biol. 2012 Feb 17;416(2):208-20. doi: 10.1016/j.jmb.2011.12.030. Epub 2011 Dec 21.
- Structural studies of Mycobacterium tuberculosis Rv0899 reveal a monomeric membrane-anchoring protein with two separate domains.
- J Mol Biol. 2012 Jan 13;415(2):382-92. doi: 10.1016/j.jmb.2011.11.016. Epub 2011 Nov 15.
- Mycobacterium tuberculosis Rv0899 adopts a mixed alpha/beta-structure and does not form a transmembrane beta-barrel.
- Biochemistry. 2010 Apr 6;49(13):2768-77. doi: 10.1021/bi100158s.
- Expression of the ompATb operon accelerates ammonia secretion and adaptation of Mycobacterium tuberculosis to acidic environments.
- Mol Microbiol. 2011 May;80(4):900-18. doi: 10.1111/j.1365-2958.2011.07619.x. Epub 2011 Mar 16.
- Proteogenomic analysis of Mycobacterium tuberculosis by high resolution mass spectrometry.
- Mol Cell Proteomics. 2011 Dec;10(12):M111.011627. doi: 10.1074/mcp.M111.011445. Epub 2011 Oct 3.
- Identification of outer membrane proteins of Mycobacterium tuberculosis.
- Tuberculosis (Edinb). 2008 Nov;88(6):526-44. doi: 10.1016/j.tube.2008.02.004. Epub 2008 Apr 25.
- The N-terminal domain of OmpATb is required for membrane translocation and pore-forming activity in mycobacteria.
- J Bacteriol. 2007 Sep;189(17):6351-8. doi: 10.1128/JB.00509-07. Epub 2007 Jun 15.
- The functions of OmpATb, a pore-forming protein of Mycobacterium tuberculosis.
- Mol Microbiol. 2002 Oct;46(1):191-201.
- Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence.
- Nature. 1998 Jun 11;393(6685):537-44. doi: 10.1038/31159.