prrA
- Type
- protein_coding
- Name
- prrA
- Locus Name
-
Rv0903c
- Product
-
Two component response transcriptional regulatory protein PrrA
- Functional Category
-
Regulatory proteins
- Location
- 1005852..1006562 (- strand)
- Gene Length
- 710 bp
- Nucleotides
-
ATGGGCGGCATGGACACTGGTGTGACCTCACCTCGGGTGTTGGTCGTCGACGACGACTCCGATGTGCTCGCCTCGCTGGAACGCGGCTTACGGCTGTCCGGATTCGAGGTAGCGACCGCGGTGGACGGCGCCGAGGCCTTGCGCAGCGCCACCGAGAACCGGCCGGACGCGATCGTGCTCGACATCAACATGCCAGTGCTCGATGGAGTCAGCGTCGTGACGGCACTACGCGCGATGGACAACGACGTCCCGGTCTGTGTGCTATCCGCACGCAGCTCTGTCGATGACCGAGTGGCCGGATTGGAGGCCGGCGCCGACGATTACCTGGTGAAACCGTTCGTGCTGGCCGAGCTGGTGGCACGGGTGAAGGCGCTGCTGCGCCGCCGCGGCTCCACTGCAACGTCGTCCTCGGAAACCATCACGGTGGGCCCGCTGGAGGTGGACATCCCCGGCCGGCGGGCCCGGGTCAACGGCGTCGACGTCGACCTGACCAAGCGCGAATTCGACCTGCTCGCGGTGCTGGCCGAGCACAAGACCGCGGTGCTCTCCCGAGCGCAACTCCTGGAATTGGTGTGGGGCTACGACTTCGCCGCCGACACCAACGTGGTGGACGTCTTCATCGGGTACCTGCGGCGCAAACTGGAGGCCGGCGGTGGCCCTAGGCTGCTGCATACCGTCCGCGGAGTCGGATTCGTGCTGCGTATGCAGTG
- Drug Resistance
- Mutations
- Function
- Member of the two-component regulatory system PrrB/PrrA. Involved specifically in early intracellular multiplication of Mycobacterium. {ECO:0000269|PubMed:11953357}.
- Family
-
Unknown
- GO
-
- growth involved in symbiotic interaction GO:0044110 biological_process
- transcription regulatory region sequence-specific DNA binding GO:0000976 molecular_function
- magnesium ion binding GO:0000287 molecular_function
- DNA-binding transcription factor activity GO:0003700 molecular_function
- DNA-binding transcription activator activity GO:0001216 molecular_function
- protein-DNA complex GO:0032993 cellular_component
- calcium ion binding GO:0005509 molecular_function
- cytosol GO:0005829 cellular_component
- plasma membrane GO:0005886 cellular_component
- phosphorelay response regulator activity GO:0000156 molecular_function
- InterPro
1YS6
- Name
- Transcriptional regulatory protein PrrA
- Family
- Unknown
- Protein Sequence
-
MDTGVTSPRVLVVDDDSDVLASLERGLRLSGFEVATAVDGAEALRSATENRPDAIVLDINMPVLDGVSVVTALRAMDNDVPVCVLSARSSVDDRVAGLEAGADDYLVKPFVLAELVARVKALLRRRGSTATSSSETITVGPLEVDIPGRRARVNGVDVDLTKREFDLLAVLAEHKTAVLSRAQLLELVWGYDFAADTNVVDVFIGYLRRKLEAGGGPRLLHTVRGVGFVLRMQ
- Mass
- 25,009 Da
- Length
- 233 Aa
Summary
Rv0903c doesn't seem to be a targeted by any drug.
-
-
Two-component system mtu02020
mtu02020Environmental Information Processing; Signal transduction
-
- Proteogenomic analysis of Mycobacterium tuberculosis by high resolution mass spectrometry.
- Mol Cell Proteomics. 2011 Dec;10(12):M111.011627. doi: 10.1074/mcp.M111.011445. Epub 2011 Oct 3.
- Transient requirement of the PrrA-PrrB two-component system for early intracellular multiplication of Mycobacterium tuberculosis.
- Infect Immun. 2002 May;70(5):2256-63. doi: 10.1128/iai.70.5.2256-2263.2002.
- Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence.
- Nature. 1998 Jun 11;393(6685):537-44. doi: 10.1038/31159.