Gene - combatTB X

pstA1

Type: protein_coding
Name: pstA1
Locus Name: Rv0930
Product: Probable phosphate-transport integral membrane ABC transporter PstA1
Functional Category: Cell wall and cell processes
Location: 1036999..1037925 (+ strand)
Gene Length: 926 bp
Nucleotides: TGAGTCCCTCAATGAGCATCGAGGCGCTCGACCAGCCGGTAAAGCCGGTGGTGTTTCGTCCGCTTACGCTGCGACGGCGGATCAAAAACAGCGTCGCGACAACGTTTTTCTTCACCTCGTTCGTGGTCGCGTTGATACCGTTGGTCTGGCTGCTTTGGGTGGTGATTGCCCGGGGTTGGTTTGCCGTCACCCGATCGGGCTGGTGGACCCACTCGCTGCGCGGCGTGCTGCCAGAGCAATTCGCCGGTGGGGTGTATCACGCCCTGTACGGCACGCTGGTGCAGGCCGGGGTGGCCGCCGTGCTGGCCGTGCCGCTGGGCTTGATGACCGCGGTTTACCTAGTGGAATACGGGACTGGTCGAATGTCGCGGGTGACTACCTTCACCGTCGACGTGCTTGCCGGCGTGCCCTCTATCGTGGCGGCGTTATTCGTCTTCAGCCTGTGGATCGCCACCCTAGGATTTCAGCAGAGCGCCTTTGCCGTGGCGTTGGCGTTGGTCCTGCTGATGTTGCCGGTGGTGGTTCGGGCAGGCGAGGAGATGCTCAGGTTGGTGCCCGATGAACTGCGAGAAGCCAGCTACGCGTTAGGCGTTCCGAAATGGAAGACGATCGTGCGGATCGTCGCCCCGATCGCGATGCCGGGCATCGTGTCAGGCATCTTGTTGTCCATCGCGCGCGTCGTCGGTGAAACCGCACCGGTTCTGGTGCTGGTCGGGTACAGCCACTCCATCAACCTCGACGTCTTCCACGGCAACATGGCCTCGCTGCCGTTGCTGATCTACACCGAACTCACCAATCCCGAGCACGCCGGCTTCCTGCGCGTCTGGGGCGCGGCGCTGACCCTGATCATCGTGGTCGCCACGATCAACCTGGCCGCGGCGATGATCCGGTTCGTCGCAACCCGACGGCGGCGACTCCCGTTATGA
Drug Resistance: Check for drug resistance association at TBDREAMDB
Mutations: Check for mutants available at TARGET

Function

Part of the binding-protein-dependent transport system for phosphate; probably responsible for the translocation of the substrate across the membrane. {ECO:0000305|PubMed:20933472}.

Family

Binding-protein-dependent transport system permease family, CysTW subfamily

GO

growth of symbiont in host GO:0044117 biological_process
inorganic phosphate transmembrane transporter activity GO:0005315 molecular_function
integral component of plasma membrane GO:0005887 cellular_component
phosphate ion transmembrane transport GO:0035435 biological_process

InterPro

UniProt: P9WG11
GenBank: Rv0930
EnsemblBacteria: Rv0930
Mycobrowser: Rv0930

Summary

Name: Phosphate transport system permease protein PstA 1
Family: Binding-protein-dependent transport system permease family, CysTW subfamily
Protein Sequence: MSPSMSIEALDQPVKPVVFRPLTLRRRIKNSVATTFFFTSFVVALIPLVWLLWVVIARGWFAVTRSGWWTHSLRGVLPEQFAGGVYHALYGTLVQAGVAAVLAVPLGLMTAVYLVEYGTGRMSRVTTFTVDVLAGVPSIVAALFVFSLWIATLGFQQSAFAVALALVLLMLPVVVRAGEEMLRLVPDELREASYALGVPKWKTIVRIVAPIAMPGIVSGILLSIARVVGETAPVLVLVGYSHSINLDVFHGNMASLPLLIYTELTNPEHAGFLRVWGAALTLIIVVATINLAAAMIRFVATRRRRLPL
Mass: 33,498 Da
Length: 308 Aa

Rv0930 doesn't seem to be a targeted by any drug.

ABC transporters mtu02010
mtu02010
Environmental Information Processing; Membrane transport

Effect of PstS sub-units or PknD deficiency on the survival of Mycobacterium tuberculosis.: Tuberculosis (Edinb). 2010 Nov;90(6):338-45. doi: 10.1016/j.tube.2010.09.004. Epub 2010 Oct 8.
Re-annotation of the genome sequence of Mycobacterium tuberculosis H37Rv.: Microbiology. 2002 Oct;148(Pt 10):2967-73. doi: 10.1099/00221287-148-10-2967.
Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence.: Nature. 1998 Jun 11;393(6685):537-44. doi: 10.1038/31159.
Identification of a second Mycobacterium tuberculosis gene cluster encoding proteins of an ABC phosphate transporter.: FEBS Lett. 1996 Sep 30;394(2):206-12.
Structure of the Mycobacterium tuberculosis antigen 88, a protein related to the Escherichia coli PstA periplasmic phosphate permease subunit.: Infect Immun. 1994 Mar;62(3):849-54.