mprA
- Type
- protein_coding
- Name
- mprA
- Locus Name
-
Rv0981
- Product
-
Mycobacterial persistence regulator MRPA (two component response transcriptional regulatory protein)
- Functional Category
-
Regulatory proteins
- Location
- 1096822..1097508 (+ strand)
- Gene Length
- 686 bp
- Nucleotides
-
TGCGAATTCTTGTCGTTGACGACGATCGTGCGGTGCGCGAGTCGCTGCGCCGGTCGCTTTCCTTCAATGGCTATTCGGTCGAACTGGCCCACGACGGGGTTGAGGCGCTCGACATGATTGCCAGCGATCGCCCCGACGCGTTGGTCCTGGATGTCATGATGCCGCGGCTGGACGGCCTCGAGGTGTGCCGTCAGCTCCGCGGCACCGGCGACGACCTGCCGATTCTGGTGCTGACCGCGCGCGACTCGGTGTCCGAGCGGGTGGCCGGGCTGGACGCCGGTGCCGACGACTACCTACCAAAGCCGTTCGCCCTCGAAGAGCTGCTGGCACGGATGCGGGCGCTGCTGCGCCGCACCAAGCCCGAGGATGCCGCCGAGTCGATGGCCATGAGGTTCTCCGACCTGACGCTGGACCCGGTAACCCGCGAAGTCAACCGTGGACAGCGCCGGATCAGCCTGACCCGCACCGAATTTGCATTGCTGGAGATGCTGATCGCCAATCCGCGGCGAGTGCTGACGCGCAGCCGTATCCTGGAAGAGGTATGGGGATTCGACTTTCCCACCTCGGGCAACGCGCTGGAAGTCTACGTCGGGTATCTACGCCGCAAGACCGAGGCCGACGGCGAGCCGCGGCTGATCCACACTGTGCGCGGAGTGGGTTACGTGCTACGTGAAACACCACCCTGA
- Drug Resistance
- Mutations
- Function
- Member of the two-component regulatory system MprB/MprA which contributes to maintaining a balance among several systems involved in stress resistance and is required for establishment and maintenance of persistent infection in the host. Functions as a transcriptional regulator that recognizes a 19-bp nucleotide motif comprizing two loosely conserved 8-bp direct DNA-binding motif repeats separated by a 3-bp spacer region. MprB/MprA is involved in regulation of numerous stress-responsive genes, including up-regulation of two sigma factors, sigE and sigB as well as pepD and mprA, and repression of multiple genes from regulons associated with hypoxia, starvation and iron metabolism. The majority of genes regulated by MprB/MprA under a particular stress condition are different from those induced during normal growth, but several genes are commonly regulated under more than one condition. {ECO:0000269|PubMed:11675502, ECO:0000269|PubMed:14638785, ECO:0000269|PubMed:15601704, ECO:0000269|PubMed:16513743, ECO:0000269|PubMed:17379732}.
- Family
-
Unknown
- GO
-
- response to alkaline pH GO:0010446 biological_process
- phosphorelay response regulator activity GO:0000156 molecular_function
- phosphorelay signal transduction system GO:0000160 biological_process
- plasma membrane GO:0005886 cellular_component
- regulation of transcription, DNA-templated GO:0006355 biological_process
- negative regulation of transcription, DNA-templated GO:0045892 biological_process
- positive regulation of transcription, DNA-templated GO:0045893 biological_process
- DNA binding GO:0003677 molecular_function
- cytosol GO:0005829 cellular_component
- cell wall GO:0005618 cellular_component
- protein-DNA complex GO:0032993 cellular_component
- DNA-binding transcription activator activity GO:0001216 molecular_function
- DNA-binding transcription factor activity GO:0003700 molecular_function
- pathogenesis GO:0009405 biological_process
- transcription regulatory region sequence-specific DNA binding GO:0000976 molecular_function
- InterPro
Summary
- Name
- Response regulator MprA (Mycobacterial persistence regulator A)
- Family
- Unknown
- Protein Sequence
-
MSVRILVVDDDRAVRESLRRSLSFNGYSVELAHDGVEALDMIASDRPDALVLDVMMPRLDGLEVCRQLRGTGDDLPILVLTARDSVSERVAGLDAGADDYLPKPFALEELLARMRALLRRTKPEDAAESMAMRFSDLTLDPVTREVNRGQRRISLTRTEFALLEMLIANPRRVLTRSRILEEVWGFDFPTSGNALEVYVGYLRRKTEADGEPRLIHTVRGVGYVLRETPP
- Mass
- 25,894 Da
- Length
- 230 Aa
Rv0981 doesn't seem to be a targeted by any drug.
-
-
Two-component system mtu02020
mtu02020Environmental Information Processing; Signal transduction
-
- Proteogenomic analysis of Mycobacterium tuberculosis by high resolution mass spectrometry.
- Mol Cell Proteomics. 2011 Dec;10(12):M111.011627. doi: 10.1074/mcp.M111.011445. Epub 2011 Oct 3.
- Evidence for complex interactions of stress-associated regulons in an mprAB deletion mutant of Mycobacterium tuberculosis.
- Microbiology. 2007 Apr;153(Pt 4):1229-42. doi: 10.1099/mic.0.29281-0.
- MprAB is a stress-responsive two-component system that directly regulates expression of sigma factors SigB and SigE in Mycobacterium tuberculosis.
- J Bacteriol. 2006 Mar;188(6):2134-43. doi: 10.1128/JB.188.6.2134-2143.2006.
- Identification and characterization of a regulatory sequence recognized by Mycobacterium tuberculosis persistence regulator MprA.
- J Bacteriol. 2005 Jan;187(1):202-12. doi: 10.1128/JB.187.1.202-212.2005.
- Functional analysis of the Mycobacterium tuberculosis MprAB two-component signal transduction system.
- Infect Immun. 2003 Dec;71(12):6962-70. doi: 10.1128/iai.71.12.6962-6970.2003.
- Mycobacterium tuberculosis signal transduction system required for persistent infections.
- Proc Natl Acad Sci U S A. 2001 Oct 23;98(22):12706-11. doi: 10.1073/pnas.221272198.
- The Mycobacterium tuberculosis ECF sigma factor sigmaE: role in global gene expression and survival in macrophages.
- Mol Microbiol. 2001 Jul;41(2):423-37.
- Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence.
- Nature. 1998 Jun 11;393(6685):537-44. doi: 10.1038/31159.