Gene - combatTB X

mprB

Type: protein_coding
Name: mprB
Locus Name: Rv0982
Product: Two component sensor kinase MprB
Functional Category: Regulatory proteins
Location: 1097508..1099022 (+ strand)
Gene Length: 1514 bp
Nucleotides: TGTGGTGGTTCCGCCGCCGAGACCGGGCGCCGCTGCGCGCCACCAGCTCATTATCCCTGCGGTGGCGGGTCATGCTGCTGGCGATGTCCATGGTCGCGATGGTGGTTGTGCTGATGTCGTTCGCCGTCTATGCGGTGATCTCGGCCGCGCTCTACAGCGACATCGACAACCAACTGCAGAGCCGGGCGCAACTGCTCATCGCCAGTGGCTCGCTGGCAGCTGATCCGGGTAAGGCAATCGAGGGTACCGCCTATTCGGATGTCAACGCGATGCTGGTCAACCCCGGCCAGTCCATCTACACCGCTCAACAGCCGGGCCAGACGCTGCCGGTCGGTGCTGCCGAGAAGGCGGTGATCCGTGGCGAGTTGTTCATGTCGCGGCGCACCACCGCCGACCAACGGGTGCTTGCCATCCGTCTGACCAACGGTAGTTCGCTGCTGATCTCCAAAAGTCTCAAGCCCACCGAAGCAGTCATGAACAAGCTGCGTTGGGTGCTATTGATCGTGGGTGGGATCGGGGTGGCGGTCGCCGCGGTGGCCGGGGGGATGGTCACCCGGGCCGGGCTGAGGCCGGTGGGCCGCCTCACCGAAGCGGCCGAGCGGGTGGCGCGAACCGACGACCTGCGGCCCATCCCCGTCTTCGGCAGCGACGAATTGGCCAGGCTGACAGAGGCATTCAATTTAATGCTGCGGGCGCTGGCCGAGTCACGGGAACGGCAGGCAAGGCTGGTTACCGACGCCGGACATGAATTGCGTACCCCGCTAACGTCGCTGCGCACCAATGTCGAACTCTTGATGGCCTCGATGGCCCCGGGGGCTCCGCGGCTACCCAAGCAGGAGATGGTCGACCTGCGTGCCGATGTGCTGGCTCAAATCGAGGAATTGTCCACACTGGTAGGCGATTTGGTGGACCTGTCCCGAGGCGACGCCGGAGAAGTGGTGCACGAGCCGGTCGACATGGCTGACGTCGTCGACCGCAGCCTGGAGCGGGTCAGGCGGCGGCGCAACGATATCCTTTTCGACGTCGAGGTGATTGGGTGGCAGGTTTATGGCGATACCGCTGGATTGTCGCGGATGGCGCTTAACCTGATGGACAACGCCGCGAAGTGGAGCCCGCCGGGCGGCCACGTGGGTGTCAGGCTGAGCCAGCTCGACGCGTCGCACGCTGAGCTGGTGGTTTCCGACCGCGGCCCGGGCATTCCCGTGCAGGAGCGCCGTCTGGTGTTTGAACGGTTTTACCGGTCGGCATCGGCACGGGCGTTGCCGGGTTCGGGCCTCGGGTTGGCGATCGTCAAACAGGTGGTGCTCAACCACGGCGGATTGCTGCGCATCGAAGACACCGACCCAGGCGGCCAGCCCCCTGGAACGTCGATTTACGTGCTGCTCCCCGGCCGTCGGATGCCGATTCCGCAGCTTCCCGGTGCGACGGCTGGCGCTCGGAGCACGGACATCGAGAACTCTCGGGGTTCGGCGAACGTTATCTCAGTGGAATCTCAGTCCACGCGCGCAACCTAG
Drug Resistance: Check for drug resistance association at TBDREAMDB
Mutations: Check for mutants available at TARGET

Function

Member of the two-component regulatory system MprB/MprA which contributes to maintaining a balance among several systems involved in stress resistance and is required for establishment and maintenance of persistent infection in the host. In response to environmental signals MprB acts as both a membrane-associated protein kinase that undergoes autophosphorylation and subsequently transfers the phosphate to MprA, and a protein phosphatase that dephosphorylates phospho-MprA. MprB/MprA is involved in regulation of numerous stress-responsive genes, including up-regulation of two sigma factors, sigE and sigB as well as pepD and mprA, and repression of multiple genes from regulons associated with hypoxia, starvation and iron metabolism. The majority of genes regulated by MprB/MprA under a particular stress condition are different from those induced during normal growth, but several genes are commonly regulated under more than one condition. {ECO:0000269|PubMed:11675502, ECO:0000269|PubMed:14638785, ECO:0000269|PubMed:15601704, ECO:0000269|PubMed:16513743, ECO:0000269|PubMed:17379732}.

Family

Unknown

GO

phosphoprotein phosphatase activity GO:0004721 molecular_function
kinase activity GO:0016301 molecular_function
phosphorelay signal transduction system GO:0000160 biological_process
phosphorelay sensor kinase activity GO:0000155 molecular_function
regulation of response to osmotic stress GO:0047484 biological_process
plasma membrane GO:0005886 cellular_component
integral component of plasma membrane GO:0005887 cellular_component
ATP binding GO:0005524 molecular_function
extracellular region GO:0005576 cellular_component
peptidyl-histidine phosphorylation GO:0018106 biological_process
pathogenesis GO:0009405 biological_process

InterPro

UniProt: P9WGL1
GenBank: Rv0982
EnsemblBacteria: Rv0982
Mycobrowser: Rv0982

Summary

Name: Signal transduction histidine-protein kinase/phosphatase MprB (EC 2.7.13.3) (EC 3.1.3.-) (Mycobacterial persistence regulator B)
Family: Unknown
Protein Sequence: MWWFRRRDRAPLRATSSLSLRWRVMLLAMSMVAMVVVLMSFAVYAVISAALYSDIDNQLQSRAQLLIASGSLAADPGKAIEGTAYSDVNAMLVNPGQSIYTAQQPGQTLPVGAAEKAVIRGELFMSRRTTADQRVLAIRLTNGSSLLISKSLKPTEAVMNKLRWVLLIVGGIGVAVAAVAGGMVTRAGLRPVGRLTEAAERVARTDDLRPIPVFGSDELARLTEAFNLMLRALAESRERQARLVTDAGHELRTPLTSLRTNVELLMASMAPGAPRLPKQEMVDLRADVLAQIEELSTLVGDLVDLSRGDAGEVVHEPVDMADVVDRSLERVRRRRNDILFDVEVIGWQVYGDTAGLSRMALNLMDNAAKWSPPGGHVGVRLSQLDASHAELVVSDRGPGIPVQERRLVFERFYRSASARALPGSGLGLAIVKQVVLNHGGLLRIEDTDPGGQPPGTSIYVLLPGRRMPIPQLPGATAGARSTDIENSRGSANVISVESQSTRAT
Mass: 54,408 Da
Length: 504 Aa

Rv0982 doesn't seem to be a targeted by any drug.

Two-component system mtu02020
mtu02020
Environmental Information Processing; Signal transduction

Proteogenomic analysis of Mycobacterium tuberculosis by high resolution mass spectrometry.: Mol Cell Proteomics. 2011 Dec;10(12):M111.011627. doi: 10.1074/mcp.M111.011445. Epub 2011 Oct 3.
targetTB: a target identification pipeline for Mycobacterium tuberculosis through an interactome, reactome and genome-scale structural analysis.: BMC Syst Biol. 2008 Dec 19;2:109. doi: 10.1186/1752-0509-2-109.
Evidence for complex interactions of stress-associated regulons in an mprAB deletion mutant of Mycobacterium tuberculosis.: Microbiology. 2007 Apr;153(Pt 4):1229-42. doi: 10.1099/mic.0.29281-0.
Mycobacterium tuberculosis invasion and traversal across an in vitro human blood-brain barrier as a pathogenic mechanism for central nervous system tuberculosis.: J Infect Dis. 2006 May 1;193(9):1287-95. doi: 10.1086/502631. Epub 2006 Mar 28.
Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence.: Nature. 1998 Jun 11;393(6685):537-44. doi: 10.1038/31159.
The Mycobacterium tuberculosis ECF sigma factor sigmaE: role in global gene expression and survival in macrophages.: Mol Microbiol. 2001 Jul;41(2):423-37.
Mycobacterium tuberculosis signal transduction system required for persistent infections.: Proc Natl Acad Sci U S A. 2001 Oct 23;98(22):12706-11. doi: 10.1073/pnas.221272198.
Functional analysis of the Mycobacterium tuberculosis MprAB two-component signal transduction system.: Infect Immun. 2003 Dec;71(12):6962-70. doi: 10.1128/iai.71.12.6962-6970.2003.
Identification and characterization of a regulatory sequence recognized by Mycobacterium tuberculosis persistence regulator MprA.: J Bacteriol. 2005 Jan;187(1):202-12. doi: 10.1128/JB.187.1.202-212.2005.
MprAB is a stress-responsive two-component system that directly regulates expression of sigma factors SigB and SigE in Mycobacterium tuberculosis.: J Bacteriol. 2006 Mar;188(6):2134-43. doi: 10.1128/JB.188.6.2134-2143.2006.