kdpE
- Type
- protein_coding
- Name
- kdpE
- Locus Name
-
Rv1027c
- Product
-
Probable transcriptional regulatory protein KdpE
- Functional Category
-
Regulatory proteins
- Location
- 1148427..1149107 (- strand)
- Gene Length
- 680 bp
- Nucleotides
-
ATGACCCTCGTCTTGGTGATTGACGACGAACCCCAGATCCTGCGCGCGCTGCGTATCAACCTGACCGTGCGTGGCTACCAGGTCATCACCGCCTCGACGGGTGCGGGTGCGCTGCGCGCCGCCGCTGAGCATCCGCCCGATGTGGTGATCCTCGACCTCGGCCTGCCGGACATGTCGGGTATCGACGTGCTCGGCGGGCTGCGTGGCTGGTTGACGGCACCGGTGATCGTGTTGTCGGCGCGTACCGATTCGTCGGACAAGGTCCAGGCCCTCGATGCGGGCGCCGACGATTACGTGACGAAACCGTTTGGAATGGACGAGTTTCTGGCTCGGCTGCGCGCAGCGGTACGGCGTAACACCGCGGCCGCCGAGTTGGAGCAGCCGGTGATCGAAACCGATTCATTCACCGTCGATCTGGCCGGCAAGAAGGTCATCAAAGACGGTGCCGAAGTGCATCTCACGCCGACCGAGTGGGGCATGCTGGAAATGCTGGCCCGCAACCGCGGCAAGTTGGTCGGCCGCGGGGAGCTTCTCAAAGAAGTGTGGGGACCGGCATATGCGACTGAAACCCATTACCTGCGGGTGTATCTGGCGCAGCTGCGGCGCAAATTGGAGGATGACCCGTCGCACCCCAAACATCTGCTGACCGAATCAGGGATGGGCTACCGCTTCGAAGCCTA
- Drug Resistance
- Mutations
- Function
- Member of the two-component regulatory system KdpD/KdpE involved in the regulation of the kdp operon. {ECO:0000250}.
- Family
-
Unknown
- GO
-
- transcription regulatory region sequence-specific DNA binding GO:0000976 molecular_function
- DNA-binding transcription factor activity GO:0003700 molecular_function
- DNA-binding transcription activator activity GO:0001216 molecular_function
- protein-DNA complex GO:0032993 cellular_component
- cytosol GO:0005829 cellular_component
- phosphorelay response regulator activity GO:0000156 molecular_function
- InterPro
Summary
- Name
- Transcriptional regulatory protein KdpE
- Family
- Unknown
- Protein Sequence
-
MTLVLVIDDEPQILRALRINLTVRGYQVITASTGAGALRAAAEHPPDVVILDLGLPDMSGIDVLGGLRGWLTAPVIVLSARTDSSDKVQALDAGADDYVTKPFGMDEFLARLRAAVRRNTAAAELEQPVIETDSFTVDLAGKKVIKDGAEVHLTPTEWGMLEMLARNRGKLVGRGELLKEVWGPAYATETHYLRVYLAQLRRKLEDDPSHPKHLLTESGMGYRFEA
- Mass
- 24,741 Da
- Length
- 226 Aa
Rv1027c doesn't seem to be a targeted by any drug.
-
-
Quorum sensing mtu02024
mtu02024Cellular Processes; Cellular community - prokaryotes
-
-
-
Two-component system mtu02020
mtu02020Environmental Information Processing; Signal transduction
-
- Proteogenomic analysis of Mycobacterium tuberculosis by high resolution mass spectrometry.
- Mol Cell Proteomics. 2011 Dec;10(12):M111.011627. doi: 10.1074/mcp.M111.011445. Epub 2011 Oct 3.
- targetTB: a target identification pipeline for Mycobacterium tuberculosis through an interactome, reactome and genome-scale structural analysis.
- BMC Syst Biol. 2008 Dec 19;2:109. doi: 10.1186/1752-0509-2-109.
- Deletion of two-component regulatory systems increases the virulence of Mycobacterium tuberculosis.
- Infect Immun. 2003 Mar;71(3):1134-40. doi: 10.1128/iai.71.3.1134-1140.2003.
- Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence.
- Nature. 1998 Jun 11;393(6685):537-44. doi: 10.1038/31159.