Gene - combatTB X

Rv1086

Type: protein_coding
Name: Rv1086
Locus Name: Rv1086
Product: Short (C15) chain Z-isoprenyl diphosphate synthase (Z-FPP synthase) (Z-farnesyl diphosphate synthase) (Z-FPP synthetase) (Z-farnesyl diphosphate synthetase) (geranyltranstransferase) (farnesyl pyrophosphate synthetase)
Functional Category: Cell wall and cell processes
Location: 1210595..1211383 (+ strand)
Gene Length: 788 bp
Nucleotides: TGGAGATCATCCCGCCGCGGCTCAAAGAGCCGTTGTACCGGCTCTACGAGCTGCGCCTGCGGCAGGGCTTGGCCGCCTCGAAATCCGACCTGCCCCGGCACATAGCCGTGCTGTGCGACGGCAACCGGCGATGGGCGCGCAGCGCGGGCTACGACGACGTCAGCTACGGCTACCGGATGGGTGCGGCCAAGATCGCCGAAATGCTGCGGTGGTGCCACGAAGCCGGCATCGAACTGGCCACCGTCTATCTGCTGTCCACCGAAAACCTGCAGCGCGATCCCGACGAGCTTGCAGCACTCATCGAGATCATCACCGATGTCGTGGAAGAGATCTGCGCACCGGCCAACCACTGGAGTGTGCGGACGGTCGGGGATCTGGGGTTGATCGGCGAGGAACCGGCCCGGCGGCTGCGCGGTGCGGTGGAATCCACCCCGGAGGTGGCCTCGTTTCATGTCAACGTTGCTGTTGGCTACGGCGGGCGCCGCGAGATCGTCGACGCTGTGCGCGCGTTGTTGAGCAAGGAACTCGCCAACGGGGCCACCGCGGAGGAACTCGTCGACGCGGTGACCGTCGAGGGTATCTCGGAAAACCTGTACACCTCAGGCCAACCCGACCCCGATTTGGTGATACGCACCTCCGGCGAGCAACGCTTGTCCGGGTTCTTGCTGTGGCAAAGCGCCTACTCGGAGATGTGGTTCACCGAGGCGCACTGGCCGGCGTTTCGCCACGTCGATTTTCTACGCGCGCTGCGTGACTACAGTGCGAGGCATCGCAGCTACGGCAGGTGA
Drug Resistance: Check for drug resistance association at TBDREAMDB
Mutations: Check for mutants available at TARGET

Function

Catalyzes the condensation of only one isopentenyl pyrophosphate (IPP) unit in the cis configuration to E-geranyl diphosphate (E-GPP) generating the 15 carbon product (2Z,6E)-farnesyl diphosphate (Z-FPP or EZ-FPP). Z-FPP is the precursor of decaprenyl diphosphate, which has a central role in the biosynthesis of the mycobacterial cell wall. {ECO:0000269|PubMed:10816587, ECO:0000269|PubMed:11004176, ECO:0000269|PubMed:11152452}.

Family

UPP synthase family, Z-FPP synthase subfamily

GO

magnesium ion binding GO:0000287 molecular_function
manganese ion binding GO:0030145 molecular_function
cytosol GO:0005829 cellular_component
plasma membrane GO:0005886 cellular_component
Z-farnesyl diphosphate synthase activity GO:0033850 molecular_function
di-trans,poly-cis-decaprenylcistransferase activity GO:0008834 molecular_function
polyprenol biosynthetic process GO:0016094 biological_process
polyprenyltransferase activity GO:0002094 molecular_function

InterPro

UniProt: P9WFF5
GenBank: Rv1086
EnsemblBacteria: Rv1086
Mycobrowser: Rv1086

Summary

Name: (2Z,6E)-farnesyl diphosphate synthase (EC 2.5.1.68) (Short-chain Z-isoprenyl diphosphate synthase) (Z-FPP synthase) (Z-FPPS) (Z-Polyprenyl diphosphate synthase) (Z-isoprenyl diphosphate synthase)
Family: UPP synthase family, Z-FPP synthase subfamily
Protein Sequence: MEIIPPRLKEPLYRLYELRLRQGLAASKSDLPRHIAVLCDGNRRWARSAGYDDVSYGYRMGAAKIAEMLRWCHEAGIELATVYLLSTENLQRDPDELAALIEIITDVVEEICAPANHWSVRTVGDLGLIGEEPARRLRGAVESTPEVASFHVNVAVGYGGRREIVDAVRALLSKELANGATAEELVDAVTVEGISENLYTSGQPDPDLVIRTSGEQRLSGFLLWQSAYSEMWFTEAHWPAFRHVDFLRALRDYSARHRSYGR
Mass: 29,410 Da
Length: 262 Aa

Rv1086 doesn't seem to be a targeted by any drug.

Terpenoid backbone biosynthesis mtu00900
mtu00900
Metabolism; Metabolism of terpenoids and polyketides

The structural basis of chain length control in Rv1086.: J Mol Biol. 2008 Aug 1;381(1):129-40. doi: 10.1016/j.jmb.2008.05.060. Epub 2008 Jul 1.
Proteogenomic analysis of Mycobacterium tuberculosis by high resolution mass spectrometry.: Mol Cell Proteomics. 2011 Dec;10(12):M111.011627. doi: 10.1074/mcp.M111.011445. Epub 2011 Oct 3.
Product chain-length determination mechanism of Z,E-farnesyl diphosphate synthase.: Biochem Biophys Res Commun. 2008 Dec 5;377(1):17-22. doi: 10.1016/j.bbrc.2008.09.014. Epub 2008 Sep 13.
Purification, enzymatic characterization, and inhibition of the Z-farnesyl diphosphate synthase from Mycobacterium tuberculosis.: J Biol Chem. 2001 Apr 13;276(15):11624-30. doi: 10.1074/jbc.M007168200. Epub 2001 Jan 4.
Identification of a short (C15) chain Z-isoprenyl diphosphate synthase and a homologous long (C50) chain isoprenyl diphosphate synthase in Mycobacterium tuberculosis.: J Biol Chem. 2000 Jul 28;275(30):22876-81. doi: 10.1074/jbc.M003194200.
Polyprenyl phosphate biosynthesis in Mycobacterium tuberculosis and Mycobacterium smegmatis.: J Bacteriol. 2000 Oct;182(20):5771-8. doi: 10.1128/jb.182.20.5771-5778.2000.
Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence.: Nature. 1998 Jun 11;393(6685):537-44. doi: 10.1038/31159.