Gene - combatTB X

Rv1129c

Type: protein_coding
Name: Rv1129c
Locus Name: Rv1129c
Product: Probable transcriptional regulator protein
Functional Category: Regulatory proteins
Location: 1253074..1254534 (- strand)
Gene Length: 1460 bp
Nucleotides: ATGACGCGGAGTAATGTCTTACCGGTGGCTAGGACGTATTCGAGGACGTTTTCCGGTGCCCGCCTGCGGCGGTTACGTCAAGAGCGCGGGCTCACCCAGGTGGCGCTGGCCAAGGCCCTGGACTTATCCACAAGCTATGTCAACCAGTTGGAGAATGACCAGCGGCCCATCACCGTGCCCGTGCTGCTTCTGCTTACCGAGCGGTTTGACCTGTCGGCGCAGTATTTCTCCTCGGATTCCGACGCACGGTTGGTGGCCGACCTGTCCGACGTCTTCACCGACATCGGCGTCGAGCACGCGGTCAGCGGCGCCCAGATCGAAGAATTCGTCGCCCGGATGCCCGAGGTCGGCCACAGCCTGGTTGCCGTGCACCGCCGGTTGCGCGCCGCCACCGAGGAACTAGAGGGCTACCGATCTCGTGCGACCGCCGAAACCGAGCTACCGCCCGCGCGGCCGATGCCGTTCGAGGAGGTCCGCGACTTCTTCTACGACCGCAACAACTACATCCACGACCTGGACATGGCGGCGGAGCGGATGTTTACCGAAAGCGGGATGCGGACCGGCGGATTGGACATCCAGCTGGCCGAGCTGATGCGGGACCGGTTCGGCATCTCGGTGGTGATCGATGACAATCTGCCCGACACCGCCAAGCGCCGCTACCACCCCGACACCAAGGTCCTTCGGGTCGCCCACTGGCTGATGCCCGGACAGCGCGCCTTCCAGATCGCCACCCAACTGGCGCTGGTGGGCCAGTCAGACCTGATCTCGTCGATCGTGGCCACCGATGACCAGCTCAGCACCGAAGCCCGCGGCGTCGCGCGCATCGGACTGGCCAACTACTTCGCCGGCGCCTTCCTGCTCCCCTACCGCGAATTCCACCGTGCCGCAGAGCAGTTACGCTATGACATCGACCTGCTGGGCCGCCGGTTCGGAGTGGGCTTCGAAACCGTCTGCCACCGGCTCTCCACACTGCAGCGCCCGCGGCAGCGAGGGATACCGTTCATCTTCGTCCGCACCGACAAGGCCGGAAACATCTCAAAGCGACAGTCCGCGACGGCGTTTCACTTCAGCCGGGTCGGCGGCAGCTGCCCGCTGTGGGTGGTCCACGACGCGTTCGCCCAGCCAGAGAGGATCGTCCGCCAGGTGGCGCAAATGCCCGACGGCAGGTCGTACTTCTGGGTGGCCAAGACCACCGCTGCCGACGGGCTCGGGTATCTGGGCCCGCACAAGAACTTCGCGGTCGGGCTGGGCTGCGACCTCGCGCACGCCCATAAACTCGTCTACTCCACCGGTGTCGTCCTGGACGACCCGAGCACGGAGGTCCCGATCGGGGCGGGCTGCAAGATCTGCAACCGAACGTCGTGCGCCCAACGTGCGTTCCCCTATCTCGGTGGTCGCGTCGCGGTCGACGAGAACGCGGGCAGCAGCTTGCCTTATTCGTCGACCGAGCAATCGGTTTG
Drug Resistance: Check for drug resistance association at TBDREAMDB
Mutations: Check for mutants available at TARGET

Function

Plays a key role in regulating expression of enzymes involved in the catabolism of short chain fatty acids (SCFA) via both the glyoxylate (acetyl degradation route) and the methylcitrate cycle (propionate degradation route) (PubMed:22916289, PubMed:24705740). Required for intracellular growth in macrophages and for the assimilation of cholesterol-derived propionate (PubMed:22365605). PrpR acts as a transcriptional activator of prpDC and icl genes when propionate is the main carbon source, and as a ramB repressor (PubMed:22916289). During growth on propionate, PrpR also acts as a transcriptional repressor of dnaA, which encodes the DnaA initiator protein responsible for initiating chromosomal replication (PubMed:24705740). It is possibly involved in the regulation of genes responsible for controlling cholesterol utilization (PubMed:22365605). {ECO:0000269|PubMed:22365605, ECO:0000269|PubMed:22916289, ECO:0000269|PubMed:24705740}.

Family

Short-chain fatty acyl-CoA assimilation regulator (ScfR) family

GO

propionate metabolic process, methylcitrate cycle GO:0019679 biological_process
response to host immune response GO:0052572 biological_process
regulation of transcription, DNA-templated GO:0006355 biological_process
response to hypoxia GO:0001666 biological_process
cholesterol metabolic process GO:0008203 biological_process
sequence-specific DNA binding GO:0043565 molecular_function

InterPro

UniProt: O06581
GenBank: Rv1129c
EnsemblBacteria: Rv1129c
Mycobrowser: Rv1129c

Summary

Name: HTH-type transcriptional regulator PrpR (Propionate regulator) (PRPR)
Family: Short-chain fatty acyl-CoA assimilation regulator (ScfR) family
Protein Sequence: MTRSNVLPVARTYSRTFSGARLRRLRQERGLTQVALAKALDLSTSYVNQLENDQRPITVPVLLLLTERFDLSAQYFSSDSDARLVADLSDVFTDIGVEHAVSGAQIEEFVARMPEVGHSLVAVHRRLRAATEELEGYRSRATAETELPPARPMPFEEVRDFFYDRNNYIHDLDMAAERMFTESGMRTGGLDIQLAELMRDRFGISVVIDDNLPDTAKRRYHPDTKVLRVAHWLMPGQRAFQIATQLALVGQSDLISSIVATDDQLSTEARGVARIGLANYFAGAFLLPYREFHRAAEQLRYDIDLLGRRFGVGFETVCHRLSTLQRPRQRGIPFIFVRTDKAGNISKRQSATAFHFSRVGGSCPLWVVHDAFAQPERIVRQVAQMPDGRSYFWVAKTTAADGLGYLGPHKNFAVGLGCDLAHAHKLVYSTGVVLDDPSTEVPIGAGCKICNRTSCAQRAFPYLGGRVAVDENAGSSLPYSSTEQSV
Mass: 54,087 Da
Length: 486 Aa

Rv1129c doesn't seem to be a targeted by any drug.

Rv1129c doesn't seem to be involved in any pathway.

Propionate represses the dnaA gene via the methylcitrate pathway-regulating transcription factor, PrpR, in Mycobacterium tuberculosis.: Antonie Van Leeuwenhoek. 2014 May;105(5):951-9. doi: 10.1007/s10482-014-0153-0. Epub 2014 Apr 5.
A novel role of the PrpR as a transcription factor involved in the regulation of methylcitrate pathway in Mycobacterium tuberculosis.: PLoS One. 2012;7(8):e43651. doi: 10.1371/journal.pone.0043651. Epub 2012 Aug 16.
Cholesterol catabolism by Mycobacterium tuberculosis requires transcriptional and metabolic adaptations.: Chem Biol. 2012 Feb 24;19(2):218-27. doi: 10.1016/j.chembiol.2011.12.016.
Proteogenomic analysis of Mycobacterium tuberculosis by high resolution mass spectrometry.: Mol Cell Proteomics. 2011 Dec;10(12):M111.011627. doi: 10.1074/mcp.M111.011445. Epub 2011 Oct 3.
Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence.: Nature. 1998 Jun 11;393(6685):537-44. doi: 10.1038/31159.