Rv1151c
- Type
- protein_coding
- Name
- Rv1151c
- Locus Name
-
Rv1151c
- Product
-
Transcriptional regulatory protein
- Functional Category
-
Regulatory proteins
- Location
- 1278904..1279617 (- strand)
- Gene Length
- 713 bp
- Nucleotides
-
ATGCGAGTGGCGGTGCTCAGCGGCGCGGGGATCTCCGCGGAAAGCGGTGTACCGACGTTCCGCGATGACAAGAACGGATTGTGGGCCCGATTCGACCCTTACGAGCTGTCCAGCACGCAAGGCTGGCTGCGCAACCCCGAGCGGGTCTGGGGATGGTACCTATGGCGCCATTATCTGGTGGCCAACGTCGAACCCAACGACGGGCATCGCGCGATCGCCGCCTGGCAGGACCATGCTGAGGTCAGCGTCATCACCCAGAATGTCGACGATCTGCACGAGCGCGCCGGCAGCGGTGCGGTGCATCACCTGCACGGCAGCCTTTTCGAATTTCGTTGTGCACGTTGTGGTGTGCCCTACACCGACGCCCTTCCGGAGATGCCCGAGCCTGCGATCGAAGTGGAGCCGCCGGTCTGCGACTGCGGCGGTCTGATCCGGCCCGACATCGTATGGTTCGGTGAGCCGCTGCCAGAGGAGCCGTGGCGGAGCGCGGTCGAGGCGACAGGGAGCGCCGACGTGATGGTCGTGGTGGGGACCTCGGCGATCGTCTACCCGGCGGCCGGTTTACCCGACCTGGCGCTGGCGCGCGGCACTGCCGTGATCGAAGTCAATCCCGAGCCCACGCCGTTGTCCGGCAGCGCGACGATCAGCATCCGCGAGTCGGCCAGCCAAGCGTTGCCGGGGCTGTTGGAGCGCCTGCCCGCCCTGCTGAAATA
- Drug Resistance
- Mutations
- Function
- NAD-dependent lysine deacetylase and desuccinylase that specifically removes acetyl and succinyl groups on target proteins. Modulates the activities of several proteins which are inactive in their acylated form (By similarity). Reactivates acetylated acetyl-CoA synthetase (ACS) through an NAD-dependent deacetylation. Is able to ADP-ribosylate itself. {ECO:0000255|HAMAP-Rule:MF_01121, ECO:0000269|PubMed:21627103, ECO:0000269|PubMed:21896569}.; FUNCTION: Involved in non-homologous end joining (NHEJ) repair of blunt, 5' overhang and 3' overhang DNA double strand breaks (DSB). {ECO:0000305}.
- Family
-
Sirtuin family, Class III subfamily
- GO
-
- NAD-dependent protein deacetylase activity GO:0034979 molecular_function
- NAD+ nucleosidase activity GO:0003953 molecular_function
- cell wall GO:0005618 cellular_component
- DNA repair GO:0006281 biological_process
- cytoplasm GO:0005737 cellular_component
- NAD+ binding GO:0070403 molecular_function
- protein auto-ADP-ribosylation GO:0070213 biological_process
- zinc ion binding GO:0008270 molecular_function
- protein deacetylation GO:0006476 biological_process
- transferase activity GO:0016740 molecular_function
- protein-succinyllysine desuccinylase activity GO:0036055 molecular_function
- protein-malonyllysine demalonylase activity GO:0036054 molecular_function
- InterPro
Summary
- Name
- NAD-dependent protein deacylase (EC 3.5.1.-) (Regulatory protein SIR2 homolog)
- Family
- Sirtuin family, Class III subfamily
- Protein Sequence
-
MRVAVLSGAGISAESGVPTFRDDKNGLWARFDPYELSSTQGWLRNPERVWGWYLWRHYLVANVEPNDGHRAIAAWQDHAEVSVITQNVDDLHERAGSGAVHHLHGSLFEFRCARCGVPYTDALPEMPEPAIEVEPPVCDCGGLIRPDIVWFGEPLPEEPWRSAVEATGSADVMVVVGTSAIVYPAAGLPDLALARGTAVIEVNPEPTPLSGSATISIRESASQALPGLLERLPALLK
- Mass
- 25,661 Da
- Length
- 237 Aa
Rv1151c doesn't seem to be a targeted by any drug.
Rv1151c doesn't seem to be involved in any pathway.
- A Sir2-like protein participates in mycobacterial NHEJ.
- PLoS One. 2011;6(5):e20045. doi: 10.1371/journal.pone.0020045. Epub 2011 May 26.
- Proteogenomic analysis of Mycobacterium tuberculosis by high resolution mass spectrometry.
- Mol Cell Proteomics. 2011 Dec;10(12):M111.011627. doi: 10.1074/mcp.M111.011445. Epub 2011 Oct 3.
- Reversible acetylation and inactivation of Mycobacterium tuberculosis acetyl-CoA synthetase is dependent on cAMP.
- Biochemistry. 2011 Jul 5;50(26):5883-92. doi: 10.1021/bi200156t. Epub 2011 Jun 10.
- Purification and characterization of the acetyl-CoA synthetase from Mycobacterium tuberculosis.
- Acta Biochim Biophys Sin (Shanghai). 2011 Nov;43(11):891-9. doi: 10.1093/abbs/gmr076. Epub 2011 Sep 6.
- Cloning and characterization of NAD-dependent protein deacetylase (Rv1151c) from Mycobacterium tuberculosis.
- Biochemistry (Mosc). 2009 Jul;74(7):743-8.
- Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence.
- Nature. 1998 Jun 11;393(6685):537-44. doi: 10.1038/31159.