mutT2
- Type
- protein_coding
- Name
- mutT2
- Locus Name
-
Rv1160
- Product
-
Probable mutator protein MutT2 (7,8-dihydro-8-oxoguanine-triphosphatase) (8-oxo-dGTPase)
- Functional Category
-
Information pathways
- Location
- 1286595..1287020 (+ strand)
- Gene Length
- 425 bp
- Nucleotides
-
TGCTGAATCAGATCGTGGTTGCCGGAGCCATCGTCCGCGGTTGCACGGTCTTGGTGGCGCAACGCGTTCGGCCACCGGAGTTGGCGGGTCGTTGGGAACTTCCCGGCGGTAAGGTCGCCGCCGGCGAAACCGAGCGCGCCGCGCTGGCCCGAGAGCTCGCCGAAGAACTGGGACTCGAGGTCGCCGACCTCGCGGTGGGCGACCGTGTGGGCGACGATATTGCGTTGAACGGCACGACGACGCTGCGGGCCTATCGCGTGCATCTGCTTGGCGGCGAACCGCGTGCGCGTGACCACCGGGCGCTGTGCTGGGTGACGGCGGCCGAACTGCACGATGTCGACTGGGTACCAGCCGACCGCGGCTGGATTGCGGACCTGGCGCGAACCCTCAACGGGTCCGCCGCAGATGTCCACCGTCGCTGTTAG
- Drug Resistance
- Mutations
- Function
- May be involved in the GO system responsible for removing an oxidatively damaged form of guanine (7,8-dihydro-8-oxoguanine, 8-oxo-dGTP) from DNA and the nucleotide pool. 8-oxo-dGTP is inserted opposite dA and dC residues of template DNA with almost equal efficiency thus leading to A.T to G.C transversions. MutT specifically degrades 8-oxo-dGTP to the monophosphate (By similarity). In vitro has 8-oxo-dGTPase activity. {ECO:0000250, ECO:0000269|PubMed:16585780}.
- Family
-
Nudix hydrolase family
- GO
-
- metal ion binding GO:0046872 molecular_function
- DNA replication GO:0006260 biological_process
- DNA repair GO:0006281 biological_process
- hydrolase activity GO:0016787 molecular_function
- InterPro
Summary
- Name
- Putative 8-oxo-dGTP diphosphatase 2 (8-oxo-dGTPase 2) (EC 3.6.1.55) (7,8-dihydro-8-oxoguanine-triphosphatase 2) (Mutator protein MutT2) (dGTP pyrophosphohydrolase 2)
- Family
- Nudix hydrolase family
- Protein Sequence
-
MLNQIVVAGAIVRGCTVLVAQRVRPPELAGRWELPGGKVAAGETERAALARELAEELGLEVADLAVGDRVGDDIALNGTTTLRAYRVHLLGGEPRARDHRALCWVTAAELHDVDWVPADRGWIADLARTLNGSAADVHRRC
- Mass
- 15,160 Da
- Length
- 141 Aa
Rv1160 doesn't seem to be a targeted by any drug.
Rv1160 doesn't seem to be involved in any pathway.
- Proteogenomic analysis of Mycobacterium tuberculosis by high resolution mass spectrometry.
- Mol Cell Proteomics. 2011 Dec;10(12):M111.011627. doi: 10.1074/mcp.M111.011445. Epub 2011 Oct 3.
- Identification of Nudix hydrolase family members with an antimutator role in Mycobacterium tuberculosis and Mycobacterium smegmatis.
- J Bacteriol. 2006 Apr;188(8):3159-61. doi: 10.1128/JB.188.8.3159-3161.2006.
- Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence.
- Nature. 1998 Jun 11;393(6685):537-44. doi: 10.1038/31159.