Rv1218c
- Type
- protein_coding
- Name
- Rv1218c
- Locus Name
-
Rv1218c
- Product
-
Probable tetronasin-transport ATP-binding protein ABC transporter
- Functional Category
-
Cell wall and cell processes
- Location
- 1361798..1362733 (- strand)
- Gene Length
- 935 bp
- Nucleotides
-
ATGTCGGCTGACAACCACCAGGTGCCCATCGAGATTCGCGGACTGACCAAGCACTTCGGGTCGGTGCGGGCGCTCGACGGGCTCGACCTCACGGTGCGCGAGGGCGAAGTGCACGGCTTCCTCGGCCCCAACGGCGCGGGCAAGTCCACGACCCTGCGCATCCTGCTAGGCCTGGTGAAGGCCGACGGCGGAAGCGTGCGGTTGCTGGGCGGTGACCCCTGGACCGACGCCGTCGACCTGCACCGCCACATCGCCTATGTTCCAGGCGATGTCACATTGTGGCCGTCGCTGACCGGTGGTGAGACCATCGACCTGCTGGCCCGCATGCGAGGCGGCATCGACAACGCTCGTCGCGCGGAACTGATCGAGCGCTTCGGCCTGGACCCAACCAAGAAGGCGCGCACCTACTCCAAGGGCAACCGCCAAAAGGTCTCCCTGATCTCGGCATTGTCGTCGCACGCCACTCTGCTGCTCTTGGATGAGCCGAGCAGCGGCCTGGACCCGTTGATGGAAAACGTGTTTCAGCAGTGCATCGGCGAAGCACGCCAACGCGGTGTGACGGTGCTGTTGTCCAGCCATATTCTGGCCGAGACCGAAGCGCTGTGCGAAAAGGTGACCATCATCCGAGCCGGCAAGACCGTCGAAAGCGGTTCACTAGACGCCTTGCGGCACCTCAGCCGCACCTCGATCAAGGCCGAAATGATCGGTGATCCAGGAGACCTCAGCCAAATCAAGGGAGTCGAGGACATCAGCATCGAGGGCACCACAGTGCGCGCCCAGGTCGACAGCGAAAGCCTGAGAGAACTCATCCAAGTGCTCGGCCACGCCGGTGTGCGCAGCCTGGTCAGTCAGCCGCCCACCCTGGAGGAGCTGTTCCTGCGCCACTACAGCCTGGGCCCCGAGGTCGCAGCCGAGCAACAGGTGGCAACGCCGTG
- Drug Resistance
- Mutations
- Function
- Probably part of the ABC transporter complex Rv1217c-Rv1218c involved in the resistance to a wide range of structurally unrelated drugs (PubMed:20921309, PubMed:23143285). Could be involved in the efflux of substrates belonging to the diverse chemical classes of novobiocins, biarylpiperazines, pyridines, bisanilinopyrimidines, pyrroles and, to a smaller extent, pyrazolones (PubMed:20921309). Probably responsible for energy coupling to the transport system (Probable). {ECO:0000269|PubMed:20921309, ECO:0000269|PubMed:23143285, ECO:0000305}.
- Family
-
ABC transporter superfamily
- GO
-
- response to antibiotic GO:0046677 biological_process
- ATP binding GO:0005524 molecular_function
- plasma membrane GO:0005886 cellular_component
- ATPase activity GO:0016887 molecular_function
- InterPro
Summary
- Name
- Multidrug efflux system ATP-binding protein Rv1218c (EC 7.6.2.-)
- Family
- ABC transporter superfamily
- Protein Sequence
-
MSADNHQVPIEIRGLTKHFGSVRALDGLDLTVREGEVHGFLGPNGAGKSTTLRILLGLVKADGGSVRLLGGDPWTDAVDLHRHIAYVPGDVTLWPSLTGGETIDLLARMRGGIDNARRAELIERFGLDPTKKARTYSKGNRQKVSLISALSSHATLLLLDEPSSGLDPLMENVFQQCIGEARQRGVTVLLSSHILAETEALCEKVTIIRAGKTVESGSLDALRHLSRTSIKAEMIGDPGDLSQIKGVEDISIEGTTVRAQVDSESLRELIQVLGHAGVRSLVSQPPTLEELFLRHYSLGPEVAAEQQVATP
- Mass
- 33,448 Da
- Length
- 311 Aa
Rv1218c doesn't seem to be a targeted by any drug.
Rv1218c doesn't seem to be involved in any pathway.
- Crystal structure of the transcriptional regulator Rv1219c of Mycobacterium tuberculosis.
- Protein Sci. 2014 Apr;23(4):423-32. doi: 10.1002/pro.2424. Epub 2014 Mar 10.
- The expression of ABC efflux pump, Rv1217c-Rv1218c, and its association with multidrug resistance of Mycobacterium tuberculosis in China.
- Curr Microbiol. 2013 Mar;66(3):222-6. doi: 10.1007/s00284-012-0215-3. Epub 2012 Nov 11.
- Proteogenomic analysis of Mycobacterium tuberculosis by high resolution mass spectrometry.
- Mol Cell Proteomics. 2011 Dec;10(12):M111.011627. doi: 10.1074/mcp.M111.011445. Epub 2011 Oct 3.
- Rv1218c, an ABC transporter of Mycobacterium tuberculosis with implications in drug discovery.
- Antimicrob Agents Chemother. 2010 Dec;54(12):5167-72. doi: 10.1128/AAC.00610-10. Epub 2010 Oct 4.
- The ATP binding cassette (ABC) transport systems of Mycobacterium tuberculosis.
- FEMS Microbiol Rev. 2000 Oct;24(4):449-67. doi: 10.1111/j.1574-6976.2000.tb00550.x.
- Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence.
- Nature. 1998 Jun 11;393(6685):537-44. doi: 10.1038/31159.