Rv1301
- Type
- protein_coding
- Name
- Rv1301
- Locus Name
-
Rv1301
- Product
-
Conserved protein
- Functional Category
-
Conserved hypotheticals
- Location
- 1457558..1458211 (+ strand)
- Gene Length
- 653 bp
- Nucleotides
-
TGACTGAGACGTTCGACTGCGCCGACCCCGAGCAGCGTTCGCGTGGAATCGTCTCTGCGGTAGGGGCAATCAAGGCGGGCCAACTGGTGGTGATGCCTACGGACACGGTGTATGGGATCGGCGCCGACGCCTTCGACAGCTCCGCGGTGGCCGCGTTGCTGTCGGCAAAGGGGCGGGGTCGCGATATGCCGGTAGGTGTGCTGGTCGGCTCTTGGCACACGATCGAGGGGCTGGTCTACTCTATGCCCGACGGTGCCCGCGAACTGATTCGCGCATTCTGGCCCGGCGCGCTCAGCCTGGTGGTCGTGCAAGCGCCGTCGCTGCAATGGGATCTTGGCGATGCCCATGGCACCGTGATGCTGCGAATGCCGCTGCACCCGGTCGCCATCGAGTTGTTGCGTGAGGTGGGTCCGATGGCGGTATCCAGCGCCAACATCTCGGGCCACCCACCCCCGGTCGACGCCGAACAGGCACGCTCTCAACTCGGCGACCACGTCGCGGTCTATCTCGACGCGGGTCCATCCGAACAGCAGGCCGGCTCCACGATCGTCGATCTGACCGGAGCCACCCCACGCGTCCTGCGGCCGGGGCCGGTCAGCACCGAGCGGATCGCCGAGGTACTTGGTGTGGACGCGGCCAGCTTGTTCGGCTAG
- Drug Resistance
- Mutations
- Function
- Required for the formation of a threonylcarbamoyl group on adenosine at position 37 (t(6)A37) in tRNAs that read codons beginning with adenine. Catalyzes the conversion of L-threonine, HCO(3)(-)/CO(2) and ATP to give threonylcarbamoyl-AMP (TC-AMP) as the acyladenylate intermediate, with the release of diphosphate. {ECO:0000250}.
- Family
-
SUA5 family
- GO
-
- L-threonylcarbamoyladenylate synthase GO:0061710 molecular_function
- double-stranded RNA binding GO:0003725 molecular_function
- ATP binding GO:0005524 molecular_function
- cytoplasm GO:0005737 cellular_component
- tRNA processing GO:0008033 biological_process
- regulation of translational fidelity GO:0006450 biological_process
- nucleotidyltransferase activity GO:0016779 molecular_function
- tRNA binding GO:0000049 molecular_function
- InterPro
Summary
- Name
- Putative threonylcarbamoyl-AMP synthase (TC-AMP synthase) (EC 2.7.7.87) (L-threonylcarbamoyladenylate synthase) (tRNA threonylcarbamoyladenosine biosynthesis protein Rv1301)
- Family
- SUA5 family
- Protein Sequence
-
MTETFDCADPEQRSRGIVSAVGAIKAGQLVVMPTDTVYGIGADAFDSSAVAALLSAKGRGRDMPVGVLVGSWHTIEGLVYSMPDGARELIRAFWPGALSLVVVQAPSLQWDLGDAHGTVMLRMPLHPVAIELLREVGPMAVSSANISGHPPPVDAEQARSQLGDHVAVYLDAGPSEQQAGSTIVDLTGATPRVLRPGPVSTERIAEVLGVDAASLFG
- Mass
- 22,571 Da
- Length
- 217 Aa
Rv1301 doesn't seem to be a targeted by any drug.
Rv1301 doesn't seem to be involved in any pathway.
- Proteogenomic analysis of Mycobacterium tuberculosis by high resolution mass spectrometry.
- Mol Cell Proteomics. 2011 Dec;10(12):M111.011627. doi: 10.1074/mcp.M111.011445. Epub 2011 Oct 3.
- Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence.
- Nature. 1998 Jun 11;393(6685):537-44. doi: 10.1038/31159.