atpG
- Type
- protein_coding
- Name
- atpG
- Locus Name
-
Rv1309
- Product
-
Probable ATP synthase gamma chain AtpG
- Functional Category
-
Intermediary metabolism and respiration
- Location
- 1464884..1465801 (+ strand)
- Gene Length
- 917 bp
- Nucleotides
-
TGGCTGCCACACTTCGCGAACTACGCGGGCGGATCCGCTCGGCAGGGTCGATCAAAAAGATCACCAAGGCCCAGGAGCTGATTGCGACATCGCGCATCGCCAGGGCGCAGGCTCGGCTCGAGTCCGCTCGGCCCTACGCTTTTGAGATCACCCGGATGCTTACCACCCTGGCCGCTGAAGCCGCACTGGACCATCCGTTGCTCGTCGAGCGCCCGGAGCCGAAACGAGCCGGCGTGCTGGTGGTGTCGTCCGATCGTGGTTTGTGCGGCGCATACAACGCCAATATTTTCCGTCGCTCCGAGGAGCTGTTCTCCCTGCTGAGGGAGGCCGGAAAGCAGCCGGTGCTGTATGTGGTGGGCCGTAAGGCGCAGAACTACTACAGTTTTCGGAACTGGAACATCACCGAGTCGTGGATGGGTTTCTCCGAGCAACCCACGTACGAGAACGCCGCCGAGATCGCTTCGACCTTAGTGGATGCGTTCCTGCTCGGCACCGACAACGGCGAGGATCAACGGTCCGACAGCGGCGAGGGCGTCGACGAACTGCACATCGTTTACACCGAGTTCAAGTCGATGCTGTCGCAATCGGCGGAGGCTCACCGGATCGCCCCCATGGTGGTGGAGTACGTCGAGGAAGACATCGGACCGCGCACGCTGTACTCGTTCGAGCCCGACGCGACGATGCTGTTCGAGTCATTGTTGCCGCGCTACCTGACTACCCGGGTGTACGCGGCGCTGCTGGAGTCCGCGGCGTCGGAGCTTGCCTCGCGGCAACGTGCGATGAAGTCGGCCACCGACAACGCCGATGACCTCATCAAGGCCCTGACGCTGATGGCAAACCGCGAGCGGCAGGCCCAGATCACCCAGGAGATTAGTGAAATCGTCGGTGGCGCAAATGCGCTCGCCGAAGCCCGCTAG
- Drug Resistance
- Mutations
- Function
- Produces ATP from ADP in the presence of a proton gradient across the membrane. The gamma chain is believed to be important in regulating ATPase activity and the flow of protons through the CF(0) complex. {ECO:0000255|HAMAP-Rule:MF_00815}.
- Family
-
ATPase gamma chain family
- GO
-
- proton-transporting ATP synthase activity, rotational mechanism GO:0046933 molecular_function
- ATP synthesis coupled proton transport GO:0015986 biological_process
- cell wall GO:0005618 cellular_component
- ATP binding GO:0005524 molecular_function
- plasma membrane GO:0005886 cellular_component
- plasma membrane ATP synthesis coupled proton transport GO:0042777 biological_process
- proton-transporting ATP synthase complex, catalytic core F(1) GO:0045261 cellular_component
- ATP biosynthetic process GO:0006754 biological_process
- InterPro
Summary
- Name
- ATP synthase gamma chain (ATP synthase F1 sector gamma subunit) (F-ATPase gamma subunit)
- Family
- ATPase gamma chain family
- Protein Sequence
-
MAATLRELRGRIRSAGSIKKITKAQELIATSRIARAQARLESARPYAFEITRMLTTLAAEAALDHPLLVERPEPKRAGVLVVSSDRGLCGAYNANIFRRSEELFSLLREAGKQPVLYVVGRKAQNYYSFRNWNITESWMGFSEQPTYENAAEIASTLVDAFLLGTDNGEDQRSDSGEGVDELHIVYTEFKSMLSQSAEAHRIAPMVVEYVEEDIGPRTLYSFEPDATMLFESLLPRYLTTRVYAALLESAASELASRQRAMKSATDNADDLIKALTLMANRERQAQITQEISEIVGGANALAEAR
- Mass
- 33,890 Da
- Length
- 305 Aa
Rv1309 doesn't seem to be a targeted by any drug.
-
-
Oxidative phosphorylation mtu00190
mtu00190PATHWAY_MAP mtu00190 Oxidative phosphorylation
-
- Proteogenomic analysis of Mycobacterium tuberculosis by high resolution mass spectrometry.
- Mol Cell Proteomics. 2011 Dec;10(12):M111.011627. doi: 10.1074/mcp.M111.011445. Epub 2011 Oct 3.
- Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence.
- Nature. 1998 Jun 11;393(6685):537-44. doi: 10.1038/31159.