cysM
- Type
- protein_coding
- Name
- cysM
- Locus Name
-
Rv1336
- Product
-
Cysteine synthase B CysM (CSASE B) (O-phosphoserine sulfhydrylase B) (O-phosphoserine (thiol)-lyase B)
- Functional Category
-
Intermediary metabolism and respiration
- Location
- 1503394..1504365 (+ strand)
- Gene Length
- 971 bp
- Nucleotides
-
TGACACGATACGACTCGCTGTTGCAGGCCTTGGGCAACACGCCGCTGGTTGGCCTGCAGCGATTGTCGCCACGCTGGGATGACGGGCGAGACGGACCGCACGTGCGGCTGTGGGCCAAGCTCGAGGACCGCAATCCGACCGGGTCGATCAAGGACCGCCCGGCTGTGCGGATGATCGAGCAGGCCGAGGCCGACGGGTTGTTGCGGCCGGGCGCCACCATCCTGGAGCCCACCAGCGGAAACACCGGCATTTCGCTGGCGATGGCGGCCCGGTTGAAGGGGTACCGATTGATCTGCGTGATGCCGGAGAACACATCGGTTGAACGGCGGCAGCTGCTCGAGCTCTACGGCGCGCAGATTATCTTCTCGGCGGCCGAAGGCGGGTCCAACACTGCGGTGGCCACCGCCAAAGAGCTGGCCGCGACCAACCCGTCATGGGTGATGCTGTACCAGTACGGCAATCCCGCCAACACCGACTCGCACTACTGCGGCACCGGCCCCGAGCTGCTGGCCGACCTGCCCGAAATCACGCACTTCGTCGCCGGCCTAGGCACCACGGGCACGCTGATGGGCACTGGCCGTTTCCTGCGCGAGCACGTTGCCAACGTCAAGATCGTGGCGGCCGAACCCCGCTACGGTGAGGGGGTATACGCCCTGCGCAACATGGACGAAGGCTTTGTGCCCGAGCTGTATGACCCGGAAATACTGACCGCGCGATATTCTGTCGGCGCGGTGGACGCAGTGCGCCGCACCCGCGAGTTGGTGCACACCGAAGGCATCTTTGCGGGCATCTCAACCGGCGCGGTGCTACACGCCGCACTCGGAGTCGGGGCCGGCGCCCTGGCGGCCGGCGAGCGGGCCGACATTGCGTTGGTGGTCGCCGACGCCGGGTGGAAGTATCTGTCCACCGGCGCCTACGCCGGTAGCCTGGATGACGCCGAGACCGCTCTGGAAGGGCAACTATGGGCATGA
- Drug Resistance
- Mutations
- Function
- Catalyzes the formation of a covalent CysO-cysteine adduct via a sulfur transfer, using the thiocarboxylated sulfur carrier protein CysO-COSH as sulfur donor and O-phospho-L-serine (OPS) as sulfur acceptor. Can also use sodium sulfide as sulfur donor in vitro, albeit with less efficiency, but not thiosulfate or thio-nitro-benzoate. O-acetylserine (OAS) is a very poor substrate in comparison with OPS. May be of particular importance for cysteine biosynthesis in the persistent phase of M.tuberculosis. {ECO:0000269|PubMed:18799456, ECO:0000269|PubMed:18842002}.
- Family
-
Cysteine synthase/cystathionine beta-synthase family
- GO
-
- protein-containing complex GO:0032991 cellular_component
- cytosol GO:0005829 cellular_component
- L-cysteine desulfhydrase activity GO:0080146 molecular_function
- cytoplasm GO:0005737 cellular_component
- pyridoxal phosphate binding GO:0030170 molecular_function
- O-phosphoserine sulfhydrylase activity GO:0033847 molecular_function
- cysteine biosynthetic process from serine GO:0006535 biological_process
- cysteine synthase activity GO:0004124 molecular_function
- InterPro
3DKI
- Name
- O-phosphoserine sulfhydrylase (OPS sulfhydrylase) (EC 2.5.1.113) (CysO-thiocarboxylate-dependent cysteine synthase) (Cysteine synthase B) (CSase B) (O-phosphoserine-specific cysteine synthase) ([CysO sulfur-carrier protein]-thiocarboxylate-dependent cysteine synthase)
- Family
- Cysteine synthase/cystathionine beta-synthase family
- Protein Sequence
-
MTRYDSLLQALGNTPLVGLQRLSPRWDDGRDGPHVRLWAKLEDRNPTGSIKDRPAVRMIEQAEADGLLRPGATILEPTSGNTGISLAMAARLKGYRLICVMPENTSVERRQLLELYGAQIIFSAAEGGSNTAVATAKELAATNPSWVMLYQYGNPANTDSHYCGTGPELLADLPEITHFVAGLGTTGTLMGTGRFLREHVANVKIVAAEPRYGEGVYALRNMDEGFVPELYDPEILTARYSVGAVDAVRRTRELVHTEGIFAGISTGAVLHAALGVGAGALAAGERADIALVVADAGWKYLSTGAYAGSLDDAETALEGQLWA
- Mass
- 34,438 Da
- Length
- 323 Aa
Summary
Rv1336 doesn't seem to be a targeted by any drug.
-
-
Cysteine synthesis from O-phosphoserine R-MTU-936654
Mycobacterium tuberculosisR-MTU-936654
-
- The C-terminal of CysM from Mycobacterium tuberculosis protects the aminoacrylate intermediate and is involved in sulfur donor selectivity.
- FEBS Lett. 2009 Jan 22;583(2):330-6. doi: 10.1016/j.febslet.2008.12.019. Epub 2008 Dec 26.
- Cysteine synthase (CysM) of Mycobacterium tuberculosis is an O-phosphoserine sulfhydrylase: evidence for an alternative cysteine biosynthesis pathway in mycobacteria.
- J Biol Chem. 2008 Nov 14;283(46):31567-74. doi: 10.1074/jbc.M804877200. Epub 2008 Sep 16.
- Crystal structure of a sulfur carrier protein complex found in the cysteine biosynthetic pathway of Mycobacterium tuberculosis.
- Biochemistry. 2008 Sep 30;47(39):10354-64. doi: 10.1021/bi800915j. Epub 2008 Sep 5.
- Proteogenomic analysis of Mycobacterium tuberculosis by high resolution mass spectrometry.
- Mol Cell Proteomics. 2011 Dec;10(12):M111.011627. doi: 10.1074/mcp.M111.011445. Epub 2011 Oct 3.
- O-phospho-L-serine and the thiocarboxylated sulfur carrier protein CysO-COSH are substrates for CysM, a cysteine synthase from Mycobacterium tuberculosis.
- Biochemistry. 2008 Nov 4;47(44):11606-15. doi: 10.1021/bi8013664. Epub 2008 Oct 9.
- Genome-wide requirements for Mycobacterium tuberculosis adaptation and survival in macrophages.
- Proc Natl Acad Sci U S A. 2005 Jun 7;102(23):8327-32. doi: 10.1073/pnas.0503272102. Epub 2005 May 31.
- Role of the extracytoplasmic-function sigma factor sigma(H) in Mycobacterium tuberculosis global gene expression.
- Mol Microbiol. 2002 Jul;45(2):365-74.
- Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence.
- Nature. 1998 Jun 11;393(6685):537-44. doi: 10.1038/31159.