ribG
- Type
- protein_coding
- Name
- ribG
- Locus Name
-
Rv1409
- Product
-
Probable bifunctional riboflavin biosynthesis protein RibG : diaminohydroxyphosphoribosylaminopyrimidine deaminase (riboflavin-specific deaminase) + 5-amino-6-(5-phosphoribosylamino) uracil reductase (HTP reductase)
- Functional Category
-
Intermediary metabolism and respiration
- Location
- 1585194..1586213 (+ strand)
- Gene Length
- 1019 bp
- Nucleotides
-
TGAACGTGGAGCAGGTCAAGAGCATCGACGAGGCTATGGGTCTCGCCATCGAGCACTCCTACCAGGTCAAAGGCACGACTTATCCAAAACCCCCAGTGGGGGCCGTCATTGTGGATCCCAACGGTCGGATCGTCGGCGCCGGCGGCACCGAGCCGGCCGGTGGCGATCATGCCGAGGTGGTGGCGCTGCGCCGGGCCGGCGGATTGGCTGCCGGCGCCATCGTGGTGGTCACCATGGAACCCTGTAACCACTACGGCAAGACTCCGCCATGCGTGAACGCTCTGATCGAAGCCAGGGTGGGGACGGTGGTCTACGCCGTCGCCGACCCGAACGGGATCGCTGGGGGTGGCGCGGGCCGGCTGTCAGCAGCGGGCCTACAGGTGCGGTCCGGGGTGTTGGCTGAACAGGTGGCGGCCGGACCGCTGCGGGAGTGGCTCCACAAGCAACGCACCGGTCTGCCGCATGTCACCTGGAAGTACGCCACCAGCATCGACGGCCGCAGCGCCGCCGCCGACGGCTCCAGCCAGTGGATCTCCAGCGAGGCCGCACGCCTGGATCTGCATCGCCGCCGCGCCATCGCCGACGCGATCTTGGTCGGCACCGGCACCGTCCTCGCCGACGACCCGGCCCTGACCGCGCGGCTGGCCGACGGCTCGCTGGCGCCGCAGCAGCCGCTGCGCGTGGTGGTGGGCAAGCGCGACATACCGCCGGAAGCACGGGTCCTCAACGACGAGGCACGCACCATGATGATCCGCACCCACGAACCTATGGAGGTGCTCAGGGCGTTGTCGGATCGCACCGACGTGCTGCTGGAAGGAGGTCCCACCCTCGCCGGCGCCTTCCTACGAGCGGGTGCGATCAACCGGATCCTGGCCTACGTCGCACCGATCCTGTTGGGCGGTCCGGTTACCGCGGTCGATGACGTCGGGGTGTCCAACATCACCAACGCGTTGCGTTGGCAGTTCGACAGCGTCGAAAAGGTCGGACCGGATCTGTTGCTGAGCTTGGTGGCTCGTTAG
- Drug Resistance
- Mutations
- Function
- Converts 2,5-diamino-6-(ribosylamino)-4(3h)-pyrimidinone 5'-phosphate into 5-amino-6-(ribosylamino)-2,4(1h,3h)-pyrimidinedione 5'-phosphate. {ECO:0000250}.
- Family
-
Cytidine and deoxycytidylate deaminase family; HTP reductase family
- GO
-
- riboflavin biosynthetic process GO:0009231 biological_process
- 5-amino-6-(5-phosphoribosylamino)uracil reductase activity GO:0008703 molecular_function
- cytosol GO:0005829 cellular_component
- plasma membrane GO:0005886 cellular_component
- diaminohydroxyphosphoribosylaminopyrimidine deaminase activity GO:0008835 molecular_function
- zinc ion binding GO:0008270 molecular_function
- InterPro
Summary
- Name
- Riboflavin biosynthesis protein RibD [Includes: Diaminohydroxyphosphoribosylaminopyrimidine deaminase (DRAP deaminase) (EC 3.5.4.26) (Riboflavin-specific deaminase); 5-amino-6-(5-phosphoribosylamino)uracil reductase (EC 1.1.1.193) (HTP reductase)]
- Family
- Cytidine and deoxycytidylate deaminase family; HTP reductase family
- Protein Sequence
-
MNVEQVKSIDEAMGLAIEHSYQVKGTTYPKPPVGAVIVDPNGRIVGAGGTEPAGGDHAEVVALRRAGGLAAGAIVVVTMEPCNHYGKTPPCVNALIEARVGTVVYAVADPNGIAGGGAGRLSAAGLQVRSGVLAEQVAAGPLREWLHKQRTGLPHVTWKYATSIDGRSAAADGSSQWISSEAARLDLHRRRAIADAILVGTGTVLADDPALTARLADGSLAPQQPLRVVVGKRDIPPEARVLNDEARTMMIRTHEPMEVLRALSDRTDVLLEGGPTLAGAFLRAGAINRILAYVAPILLGGPVTAVDDVGVSNITNALRWQFDSVEKVGPDLLLSLVAR
- Mass
- 35,367 Da
- Length
- 339 Aa
Rv1409 doesn't seem to be a targeted by any drug.
-
-
Quorum sensing mtu02024
mtu02024Cellular Processes; Cellular community - prokaryotes
-
-
-
Riboflavin metabolism mtu00740
mtu00740PATHWAY_MAP mtu00740 Riboflavin metabolism
-
- Proteogenomic analysis of Mycobacterium tuberculosis by high resolution mass spectrometry.
- Mol Cell Proteomics. 2011 Dec;10(12):M111.011627. doi: 10.1074/mcp.M111.011445. Epub 2011 Oct 3.
- targetTB: a target identification pipeline for Mycobacterium tuberculosis through an interactome, reactome and genome-scale structural analysis.
- BMC Syst Biol. 2008 Dec 19;2:109. doi: 10.1186/1752-0509-2-109.
- Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence.
- Nature. 1998 Jun 11;393(6685):537-44. doi: 10.1038/31159.