Gene - combatTB X

ripA

Type: protein_coding
Name: ripA
Locus Name: Rv1477
Product: Peptidoglycan hydrolase
Functional Category: Virulence, detoxification, adaptation
Location: 1666990..1668408 (+ strand)
Gene Length: 1418 bp
Nucleotides: TGAGACGGAATCGCCGTGGCTCGCCAGCGCGACCGGCCGCACGGTTTGTCCGTCCGGCAATTCCGTCGGCTTTGAGTGTGGCCCTGCTGGTATGCACACCGGGGCTGGCTACCGCCGATCCACAGACGGACACCATCGCCGCGCTGATTGCCGACGTCGCCAAGGCCAACCAGCGCCTGCAAGACCTGAGCGACGAGGTTCAGGCCGAACAGGAAAGCGTTAACAAGGCGATGGTCGACGTGGAAACCGCTCGGGACAACGCTGCCGCGGCCGAAGACGACCTGGAGGTCAGCCAGCGCGCGGTTAAGGACGCCAACGCGGCGATCGCCGCGGCTCAGCACCGGTTCGACACCTTCGCGGCGGCCACCTACATGAACGGTCCCTCGGTCAGCTACCTCAGCGCGAGCAGCCCCGACGAGATCATTGCCACTGTGACCGCCGCCAAGACCCTTAGCGCCAGTTCCCAAGCGGTGATGGCCAACCTGCAGCGGGCCCGGACCGAGCGGGTGAACACGGAGTCGGCGGCGCGGCTAGCCAAGCAGAAGGCTGATAAGGCCGCCGCCGACGCAAAGGCCAGCCAGGATGCCGCGGTGGCGGCGCTCACCGAGACCCGGCGGAAGTTCGATGAACAGCGCGAGGAGGTCCAACGCCTGGCCGCCGAGCGCGATGCGGCTCAAGCCCGACTGCAGGCGGCCAGGTTGGTTGCCTGGTCCTCGGAGGGTGGTCAGGGTGCGCCGCCGTTCCGGATGTGGGATCCCGGATCGGGCCCTGCCGGTGGGCGTGCATGGGATGGCTTGTGGGACCCCACGCTGCCCATGATCCCCAGCGCCAACATCCCCGGCGACCCGATCGCGGTAGTGAACCAGGTGTTGGGGATCTCGGCAACGTCAGCGCAGGTCACCGCCAATATGGGGCGCAAGTTCCTGGAGCAGCTGGGCATCTTGCAGCCCACCGATACCGGCATCACCAACGCTCCGGCGGGCTCGGCCCAGGGCCGGATTCCGCGAGTTTATGGGCGCCAGGCTTCTGAATACGTGATCCGCCGCGGCATGTCACAGATCGGGGTGCCCTATTCCTGGGGCGGCGGCAATGCCGCGGGCCCGAGCAAGGGCATCGACTCCGGGGCCGGCACCGTCGGCTTCGACTGCTCAGGCCTGGTGTTGTACTCGTTTGCTGGGGTGGGCATCAAGCTGCCGCACTACTCGGGTTCGCAGTACAACCTGGGCCGCAAGATCCCGTCCTCGCAGATGCGCCGCGGCGACGTCATCTTCTACGGCCCGAACGGTAGCCAGCACGTGACGATCTACCTCGGCAACGGCCAGATGCTCGAGGCGCCCGACGTCGGTTTGAAGGTGCGGGTTGCGCCCGTGCGCACGGCTGGCATGACCCCGTATGTGGTCCGATACATCGAGTACTAG
Drug Resistance: Check for drug resistance association at TBDREAMDB
Mutations: Check for mutants available at TARGET

Function

Peptidoglycan endopeptidase that cleaves the bond between D-glutamate and meso-diaminopimelate. Binds and degrades high-molecular weight peptidoglycan from a number of Actinobacteria; activity is increased in the presence of RpfB and inhibited by PBP1A (ponA1). Required for normal separation of daughter cells after cell division and for cell wall integrity. Required for host cell invasion and intracellular survival in host macrophages. {ECO:0000269|PubMed:16495549, ECO:0000269|PubMed:17919286, ECO:0000269|PubMed:18463693, ECO:0000269|PubMed:20826344, ECO:0000269|PubMed:21864539}.

Family

Peptidase C40 family

GO

cell wall organization GO:0071555 biological_process
cell wall organization or biogenesis GO:0071554 biological_process
N-acetylmuramoyl-L-alanine amidase activity GO:0008745 molecular_function
cell wall GO:0005618 cellular_component
extracellular region GO:0005576 cellular_component
cysteine-type peptidase activity GO:0008234 molecular_function

InterPro

UniProt: O53168
GenBank: Rv1477
EnsemblBacteria: Rv1477
Mycobrowser: Rv1477

PDB IDs:

Summary

Name: Peptidoglycan endopeptidase RipA (EC 3.4.-.-) (Macrophage invasion and intracellular persistence protein A) (Resuscitation-promoting factor interaction partner A) (Rpf-interacting protein A)
Family: Peptidase C40 family
Protein Sequence: MRRNRRGSPARPAARFVRPAIPSALSVALLVCTPGLATADPQTDTIAALIADVAKANQRLQDLSDEVQAEQESVNKAMVDVETARDNAAAAEDDLEVSQRAVKDANAAIAAAQHRFDTFAAATYMNGPSVSYLSASSPDEIIATVTAAKTLSASSQAVMANLQRARTERVNTESAARLAKQKADKAAADAKASQDAAVAALTETRRKFDEQREEVQRLAAERDAAQARLQAARLVAWSSEGGQGAPPFRMWDPGSGPAGGRAWDGLWDPTLPMIPSANIPGDPIAVVNQVLGISATSAQVTANMGRKFLEQLGILQPTDTGITNAPAGSAQGRIPRVYGRQASEYVIRRGMSQIGVPYSWGGGNAAGPSKGIDSGAGTVGFDCSGLVLYSFAGVGIKLPHYSGSQYNLGRKIPSSQMRRGDVIFYGPNGSQHVTIYLGNGQMLEAPDVGLKVRVAPVRTAGMTPYVVRYIEY
Mass: 49,808 Da
Length: 472 Aa

Rv1477 doesn't seem to be a targeted by any drug.

Rv1477 doesn't seem to be involved in any pathway.

Peptidoglycan remodeling in Mycobacterium tuberculosis: comparison of structures and catalytic activities of RipA and RipB.: J Mol Biol. 2011 Oct 14;413(1):247-60. doi: 10.1016/j.jmb.2011.08.014. Epub 2011 Aug 16.
Structure and functional regulation of RipA, a mycobacterial enzyme essential for daughter cell separation.: Structure. 2010 Sep 8;18(9):1184-90. doi: 10.1016/j.str.2010.06.007.
Proteogenomic analysis of Mycobacterium tuberculosis by high resolution mass spectrometry.: Mol Cell Proteomics. 2011 Dec;10(12):M111.011627. doi: 10.1074/mcp.M111.011445. Epub 2011 Oct 3.
Interaction and modulation of two antagonistic cell wall enzymes of mycobacteria.: PLoS Pathog. 2010 Jul 29;6(7):e1001020. doi: 10.1371/journal.ppat.1001020.
A mycobacterial enzyme essential for cell division synergizes with resuscitation-promoting factor.: PLoS Pathog. 2008 Feb 29;4(2):e1000001. doi: 10.1371/journal.ppat.1000001.
targetTB: a target identification pipeline for Mycobacterium tuberculosis through an interactome, reactome and genome-scale structural analysis.: BMC Syst Biol. 2008 Dec 19;2:109. doi: 10.1186/1752-0509-2-109.
A partner for the resuscitation-promoting factors of Mycobacterium tuberculosis.: Mol Microbiol. 2007 Nov;66(3):658-68. doi: 10.1111/j.1365-2958.2007.05945.x. Epub 2007 Oct 4.
A mycobacterial operon essential for virulence in vivo and invasion and intracellular persistence in macrophages.: Infect Immun. 2006 Mar;74(3):1757-67. doi: 10.1128/IAI.74.3.1757-1767.2006.
Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence.: Nature. 1998 Jun 11;393(6685):537-44. doi: 10.1038/31159.