- Type
- protein_coding
- Name
- inhA
- Locus Name
-
Rv1484
- Product
-
NADH-dependent enoyl-[acyl-carrier-protein] reductase InhA (NADH-dependent enoyl-ACP reductase)
- Functional Category
-
Lipid metabolism
- Location
-
1674202..1675011
(+ strand)
- Gene Length
-
809
bp
- Nucleotides
-
TGACAGGACTGCTGGACGGCAAACGGATTCTGGTTAGCGGAATCATCACCGACTCGTCGATCGCGTTTCACATCGCACGGGTAGCCCAGGAGCAGGGCGCCCAGCTGGTGCTCACCGGGTTCGACCGGCTGCGGCTGATTCAGCGCATCACCGACCGGCTGCCGGCAAAGGCCCCGCTGCTCGAACTCGACGTGCAAAACGAGGAGCACCTGGCCAGCTTGGCCGGCCGGGTGACCGAGGCGATCGGGGCGGGCAACAAGCTCGACGGGGTGGTGCATTCGATTGGGTTCATGCCGCAGACCGGGATGGGCATCAACCCGTTCTTCGACGCGCCCTACGCGGATGTGTCCAAGGGCATCCACATCTCGGCGTATTCGTATGCTTCGATGGCCAAGGCGCTGCTGCCGATCATGAACCCCGGAGGTTCCATCGTCGGCATGGACTTCGACCCGAGCCGGGCGATGCCGGCCTACAACTGGATGACGGTCGCCAAGAGCGCGTTGGAGTCGGTCAACAGGTTCGTGGCGCGCGAGGCCGGCAAGTACGGTGTGCGTTCGAATCTCGTTGCCGCAGGCCCTATCCGGACGCTGGCGATGAGTGCGATCGTCGGCGGTGCGCTCGGCGAGGAGGCCGGCGCCCAGATCCAGCTGCTCGAGGAGGGCTGGGATCAGCGCGCTCCGATCGGCTGGAACATGAAGGATGCGACGCCGGTCGCCAAGACGGTGTGCGCGCTGCTGTCTGACTGGCTGCCGGCGACCACGGGTGACATCATCTACGCCGACGGCGGCGCGCACACCCAATTGCTCTAG
- Drug Resistance
-
Check for drug resistance
association at TBDREAMDB
- Mutations
-
Check for mutants available at
TARGET
- Function
- Enoyl-ACP reductase of the type II fatty acid syntase (FAS-II) system, which is involved in the biosynthesis of mycolic acids, a major component of mycobacterial cell walls (PubMed:25227413). Catalyzes the NADH-dependent reduction of the double bond of 2-trans-enoyl-[acyl-carrier protein], an essential step in the fatty acid elongation cycle of the FAS-II pathway (PubMed:7599116). Shows preference for long-chain fatty acyl thioester substrates (>C16), and can also use 2-trans-enoyl-CoAs as alternative substrates (PubMed:7599116). The mycobacterial FAS-II system utilizes the products of the FAS-I system as primers to extend fatty acyl chain lengths up to C56, forming the meromycolate chain that serves as the precursor for final mycolic acids (PubMed:25227413). {ECO:0000269|PubMed:7599116, ECO:0000303|PubMed:25227413}.; FUNCTION: Is the primary target of the first-line antitubercular drug isoniazid (INH) and of the second-line drug ethionamide (ETH) (PubMed:8284673, PubMed:12406221, PubMed:16906155, PubMed:17227913). Overexpressed inhA confers INH and ETH resistance to M.tuberculosis (PubMed:12406221). The mechanism of isoniazid action against InhA is covalent attachment of the activated form of the drug to the nicotinamide ring of NAD and binding of the INH-NAD adduct to the active site of InhA (PubMed:9417034, PubMed:16906155). Similarly, the ETH-NAD adduct binds InhA (PubMed:17227913). {ECO:0000269|PubMed:12406221, ECO:0000269|PubMed:16906155, ECO:0000269|PubMed:17227913, ECO:0000269|PubMed:9417034, ECO:0000305|PubMed:8284673}.
- Family
-
Short-chain dehydrogenases/reductases (SDR) family, FabI subfamily
- GO
-
- InterPro
-
1BVR
-
- Name
-
Enoyl-[acyl-carrier-protein] reductase [NADH] (ENR) (Enoyl-ACP reductase) (EC 1.3.1.9) (FAS-II enoyl-ACP reductase) (NADH-dependent 2-trans-enoyl-ACP reductase)
- Family
-
Short-chain dehydrogenases/reductases (SDR) family, FabI subfamily
- Protein
Sequence
-
MTGLLDGKRILVSGIITDSSIAFHIARVAQEQGAQLVLTGFDRLRLIQRITDRLPAKAPLLELDVQNEEHLASLAGRVTEAIGAGNKLDGVVHSIGFMPQTGMGINPFFDAPYADVSKGIHISAYSYASMAKALLPIMNPGGSIVGMDFDPSRAMPAYNWMTVAKSALESVNRFVAREAGKYGVRSNLVAAGPIRTLAMSAIVGGALGEEAGAQIQLLEEGWDQRAPIGWNMKDATPVAKTVCALLSDWLPATTGDIIYADGGAHTQLL
-
Mass
-
28,528
Da
-
Length
-
269
Aa
- Triclosan
DB08604
-
2,4,4'-Trichloro-2'-hydroxydiphenyl ether | 5-Chloro-2-(2,4-dichloro-phenoxy)-phenol | Triclosan | Triclosanum
- Isoniazid
DB00951
-
4-pyridinecarbohydrazide | INH | Isoniazid | Isonicotinic acid hydrazide | Isonicotinic hydrazide | Isonicotinohydrazide | Isonicotinoylhydrazide | Isonicotinsaeurehydrazid | Isonicotinylhydrazine | Pyridine-4-carboxylic acid hydrazide
- Ethionamide
DB00609
-
2-Ethyl-4-thiopyridylamide | 2-ethylthioisonicotinamide | ETH | Ethinamide | Ethionamide | Ethionamidum | Ethioniamide | Ethylisothiamide | Ethyonomide | Etionamid | Etionamida | Etionamide | Etioniamid | ETP
Rv1484 doesn't seem to be involved in any
pathway.
-
Antitubercular drugs for an old target: GSK693 as a promising InhA direct inhibitor.
- EBioMedicine. 2016 Jun;8:291-301. doi: 10.1016/j.ebiom.2016.05.006. Epub 2016 May 8.
-
N-Benzyl-4-((heteroaryl)methyl)benzamides: A New Class of Direct NADH-Dependent 2-trans Enoyl-Acyl Carrier Protein Reductase (InhA) Inhibitors with Antitubercular Activity.
- ChemMedChem. 2016 Apr 5;11(7):687-701. doi: 10.1002/cmdc.201600020. Epub 2016 Mar 2.
-
Direct inhibitors of InhA are active against Mycobacterium tuberculosis.
- Sci Transl Med. 2015 Jan 7;7(269):269ra3. doi: 10.1126/scitranslmed.3010597.
-
Crystal structure of the enoyl-ACP reductase of Mycobacterium tuberculosis (InhA) in the apo-form and in complex with the active metabolite of isoniazid pre-formed by a biomimetic approach.
- J Struct Biol. 2015 Jun;190(3):328-37. doi: 10.1016/j.jsb.2015.04.008. Epub 2015 Apr 17.
-
Rational Modulation of the Induced-Fit Conformational Change for Slow-Onset Inhibition in Mycobacterium tuberculosis InhA.
- Biochemistry. 2015 Aug 4;54(30):4683-91. doi: 10.1021/acs.biochem.5b00284. Epub 2015 Jul 24.
-
Pyridomycin bridges the NADH- and substrate-binding pockets of the enoyl reductase InhA.
- Nat Chem Biol. 2014 Feb;10(2):96-8. doi: 10.1038/nchembio.1405. Epub 2013 Dec 1.
-
Time-dependent diaryl ether inhibitors of InhA: structure-activity relationship studies of enzyme inhibition, antibacterial activity, and in vivo efficacy.
- ChemMedChem. 2014 Apr;9(4):776-91. doi: 10.1002/cmdc.201300429. Epub 2014 Mar 11.
-
A structural and energetic model for the slow-onset inhibition of the Mycobacterium tuberculosis enoyl-ACP reductase InhA.
- ACS Chem Biol. 2014 Apr 18;9(4):986-93. doi: 10.1021/cb400896g. Epub 2014 Mar 10.
-
Methyl-thiazoles: a novel mode of inhibition with the potential to develop novel inhibitors targeting InhA in Mycobacterium tuberculosis.
- J Med Chem. 2013 Nov 14;56(21):8533-42. doi: 10.1021/jm4012033. Epub 2013 Oct 25.
-
Towards a new tuberculosis drug: pyridomycin - nature's isoniazid.
- EMBO Mol Med. 2012 Oct;4(10):1032-42. doi: 10.1002/emmm.201201689. Epub 2012 Sep 17.
-
Phosphorylation of InhA inhibits mycolic acid biosynthesis and growth of Mycobacterium tuberculosis.
- Mol Microbiol. 2010 Dec;78(6):1591-605. doi: 10.1111/j.1365-2958.2010.07446.x. Epub 2010 Nov 9.
-
A slow, tight binding inhibitor of InhA, the enoyl-acyl carrier protein reductase from Mycobacterium tuberculosis.
- J Biol Chem. 2010 May 7;285(19):14330-7. doi: 10.1074/jbc.M109.090373. Epub 2010 Mar 3.
-
Triclosan derivatives: towards potent inhibitors of drug-sensitive and drug-resistant Mycobacterium tuberculosis.
- ChemMedChem. 2009 Feb;4(2):241-8. doi: 10.1002/cmdc.200800261.
-
Crystallographic studies on the binding of isonicotinyl-NAD adduct to wild-type and isoniazid resistant 2-trans-enoyl-ACP (CoA) reductase from Mycobacterium tuberculosis.
- J Struct Biol. 2007 Sep;159(3):369-80. doi: 10.1016/j.jsb.2007.04.009. Epub 2007 May 3.
-
Mechanism of thioamide drug action against tuberculosis and leprosy.
- J Exp Med. 2007 Jan 22;204(1):73-8. doi: 10.1084/jem.20062100. Epub 2007 Jan 16.
-
New insight into the mechanism of action of and resistance to isoniazid: interaction of Mycobacterium tuberculosis enoyl-ACP reductase with INH-NADP.
- J Am Chem Soc. 2007 Aug 8;129(31):9582-3. doi: 10.1021/ja073160k. Epub 2007 Jul 18.
-
Inhibition of the Mycobacterium tuberculosis enoyl acyl carrier protein reductase InhA by arylamides.
- Bioorg Med Chem. 2007 Nov 1;15(21):6649-58. doi: 10.1016/j.bmc.2007.08.013. Epub 2007 Aug 15.
-
Transfer of a point mutation in Mycobacterium tuberculosis inhA resolves the target of isoniazid.
- Nat Med. 2006 Sep;12(9):1027-9. doi: 10.1038/nm1466. Epub 2006 Aug 13.
-
Crystallographic and pre-steady-state kinetics studies on binding of NADH to wild-type and isoniazid-resistant enoyl-ACP(CoA) reductase enzymes from Mycobacterium tuberculosis.
- J Mol Biol. 2006 Jun 9;359(3):646-66. doi: 10.1016/j.jmb.2006.03.055. Epub 2006 Apr 21.
-
Pyrrolidine carboxamides as a novel class of inhibitors of enoyl acyl carrier protein reductase from Mycobacterium tuberculosis.
- J Med Chem. 2006 Oct 19;49(21):6308-23. doi: 10.1021/jm060715y.
-
High affinity InhA inhibitors with activity against drug-resistant strains of Mycobacterium tuberculosis.
- ACS Chem Biol. 2006 Feb 17;1(1):43-53. doi: 10.1021/cb0500042.
-
Targeting tuberculosis and malaria through inhibition of Enoyl reductase: compound activity and structural data.
- J Biol Chem. 2003 Jun 6;278(23):20851-9. doi: 10.1074/jbc.M211968200. Epub 2003 Feb 26.
-
Crystal structure of the Mycobacterium tuberculosis enoyl-ACP reductase, InhA, in complex with NAD+ and a C16 fatty acyl substrate.
- J Biol Chem. 1999 May 28;274(22):15582-9. doi: 10.1074/jbc.274.22.15582.
-
Modification of the NADH of the isoniazid target (InhA) from Mycobacterium tuberculosis.
- Science. 1998 Jan 2;279(5347):98-102. doi: 10.1126/science.279.5347.98.
-
Crystal structure and function of the isoniazid target of Mycobacterium tuberculosis.
- Science. 1995 Mar 17;267(5204):1638-41. doi: 10.1126/science.7886450.
-
Crucial components of Mycobacterium type II fatty acid biosynthesis (Fas-II) and their inhibitors.
- FEMS Microbiol Lett. 2014 Nov;360(2):87-99. doi: 10.1111/1574-6968.12597. Epub 2014 Oct 21.
-
Targeting InhA, the FASII enoyl-ACP reductase: SAR studies on novel inhibitor scaffolds.
- Curr Top Med Chem. 2012;12(7):672-93.
-
Proteogenomic analysis of Mycobacterium tuberculosis by high resolution mass spectrometry.
- Mol Cell Proteomics. 2011 Dec;10(12):M111.011627. doi: 10.1074/mcp.M111.011445. Epub 2011 Oct 3.
-
Phosphorylation of enoyl-acyl carrier protein reductase InhA impacts mycobacterial growth and survival.
- J Biol Chem. 2010 Nov 26;285(48):37860-71. doi: 10.1074/jbc.M110.143131. Epub 2010 Sep 23.
-
targetTB: a target identification pipeline for Mycobacterium tuberculosis through an interactome, reactome and genome-scale structural analysis.
- BMC Syst Biol. 2008 Dec 19;2:109. doi: 10.1186/1752-0509-2-109.
-
The isoniazid-NAD adduct is a slow, tight-binding inhibitor of InhA, the Mycobacterium tuberculosis enoyl reductase: adduct affinity and drug resistance.
- Proc Natl Acad Sci U S A. 2003 Nov 25;100(24):13881-6. doi: 10.1073/pnas.2235848100. Epub 2003 Nov 17.
-
Overexpression of inhA, but not kasA, confers resistance to isoniazid and ethionamide in Mycobacterium smegmatis, M. bovis BCG and M. tuberculosis.
- Mol Microbiol. 2002 Oct;46(2):453-66.
-
Roles of tyrosine 158 and lysine 165 in the catalytic mechanism of InhA, the enoyl-ACP reductase from Mycobacterium tuberculosis.
- Biochemistry. 1999 Oct 12;38(41):13623-34. doi: 10.1021/bi990529c.
-
Enzymatic characterization of the target for isoniazid in Mycobacterium tuberculosis.
- Biochemistry. 1995 Jul 4;34(26):8235-41. doi: 10.1021/bi00026a004.
-
Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence.
- Nature. 1998 Jun 11;393(6685):537-44. doi: 10.1038/31159.
-
inhA, a gene encoding a target for isoniazid and ethionamide in Mycobacterium tuberculosis.
- Science. 1994 Jan 14;263(5144):227-30. doi: 10.1126/science.8284673.