lprI
- Type
- protein_coding
- Name
- lprI
- Locus Name
-
Rv1541c
- Product
-
Possible lipoprotein LprI
- Functional Category
-
Cell wall and cell processes
- Location
- 1743778..1744371 (- strand)
- Gene Length
- 593 bp
- Nucleotides
-
ATGAGATGGATCGGCGTCCTGGTGACCGCCCTGGTTCTGAGCGCCTGCGCCGCAAACCCTCCGGCTAACACAACCTCGCCGACCGCCGGGCAGTCGCTCGACTGCACCAAACCGGCAACCATAGTGCAGCAACTGGTTTGCCACGACCGGCAGTTGACCAGTCTGGACCACCGGCTTTCGACCGCCTATCAACAGGCGCTGGCCCATCGACGCTCGGCGGCGCTGGAAGCCGCACAAAGCAGCTGGACGATGCTGCGTGATGCTTGTGCGCAAGACACCGACCCGCGTACCTGTGTGCAGGAGGCCTACCAGACCCGGCTGGTCCAATTGGCAATCGCCGATCCCGCCACCGCGACTCCACCCGTCCTCACCTACCGGTGTCCCACGCAGGACGGCCCATTGACCGCACAGTTCTACAACCAATTCGACCCGAAGACGGCCGTGCTCAACTGGAAAGGCGACCAAGTGATCGTGTTCGTCGAACTGTCCGGCAGTGGCGCCCGGTATGGTCGCCAAGGCATTGAATACTGGGAACACCAGGGCGAGGTGCGCCTCGATTTCCATGGCGCCACGTTCGTCTGCCGCACCTCGTG
- Drug Resistance
- Mutations
- Function
- Strongly binds and inhibits lysozyme, may help bacteria survive in lysozyme-producing host cells. When overexpressed in M.tuberculosis or M.smegmatis increases resistance to hen egg white lysozyme. M.smegmatis overexpressing LprI survive better during intracellular infection of peritoneal and monocyte-derived macrophages, both of which produce lysozyme during infection; M.smegmatis does not encode this protein. Somewhat better survival is seen in human cell lines when M.smegmatis cells express both proteins from this operon, i.e. GlbN (HbN) and LprI. {ECO:0000269|PubMed:26589796}.
- Family
-
MliC family
- GO
-
- cell surface GO:0009986 cellular_component
- cell wall GO:0005618 cellular_component
- extracellular region GO:0005576 cellular_component
- plasma membrane GO:0005886 cellular_component
- InterPro
Summary
- Name
- Lipoprotein LprI (Glycolipoprotein LprI) (Lysozyme inhibitor LprI)
- Family
- MliC family
- Protein Sequence
-
MRWIGVLVTALVLSACAANPPANTTSPTAGQSLDCTKPATIVQQLVCHDRQLTSLDHRLSTAYQQALAHRRSAALEAAQSSWTMLRDACAQDTDPRTCVQEAYQTRLVQLAIADPATATPPVLTYRCPTQDGPLTAQFYNQFDPKTAVLNWKGDQVIVFVELSGSGARYGRQGIEYWEHQGEVRLDFHGATFVCRTS
- Mass
- 21,624 Da
- Length
- 197 Aa
Rv1541c doesn't seem to be a targeted by any drug.
Rv1541c doesn't seem to be involved in any pathway.
- Lipoprotein LprI of Mycobacterium tuberculosis Acts as a Lysozyme Inhibitor.
- J Biol Chem. 2016 Feb 5;291(6):2938-53. doi: 10.1074/jbc.M115.662593. Epub 2015 Nov 20.
- Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence.
- Nature. 1998 Jun 11;393(6685):537-44. doi: 10.1038/31159.