lprJ
- Type
- protein_coding
- Name
- lprJ
- Locus Name
-
Rv1690
- Product
-
Probable lipoprotein LprJ
- Functional Category
-
Cell wall and cell processes
- Location
- 1915527..1915910 (+ strand)
- Gene Length
- 383 bp
- Nucleotides
-
TGACGGCACACACACACGACGGGACACGGACCTGGCGAACGGGCCGGCAGGCGACGACGTTGCTCGCGTTGCTGGCCGGGGTGTTTGGTGGTGCCGCGAGCTGCGCGGCGCCGATCCAGGCCGACATGATGGGTAACGCATTCCTGACAGCGTTGACCAACGCCGGCATTGCCTATGACCAACCGGCGACCACGGTGGCGCTAGGCAGATCGGTTTGTCCGATGGTGGTTGCGCCGGGCGGGACGTTCGAATCGATCACGTCCAGAATGGCTGAGATCAATGGCATGTCGCGTGATATGGCGAGTACGTTCACCATTGTCGCGATTGGGACGTATTGCCCGGCGGTGATTGCGCCGCTGATGCCTAACCGGTTACAGGCCTGA
- Drug Resistance
- Mutations
- Function
- Overexpression induces expression of sensor protein kdpD gene at low K(+) concentrations (0 and 250 uM, tested in M.smegatis). {ECO:0000269|PubMed:12581360}.
- Family
-
Unknown
- GO
-
- plasma membrane GO:0005886 cellular_component
- integral component of membrane GO:0016021 cellular_component
- InterPro
Summary
- Name
- Putative lipoprotein LprJ
- Family
- Unknown
- Protein Sequence
-
MTAHTHDGTRTWRTGRQATTLLALLAGVFGGAASCAAPIQADMMGNAFLTALTNAGIAYDQPATTVALGRSVCPMVVAPGGTFESITSRMAEINGMSRDMASTFTIVAIGTYCPAVIAPLMPNRLQA
- Mass
- 13,106 Da
- Length
- 127 Aa
Rv1690 doesn't seem to be a targeted by any drug.
Rv1690 doesn't seem to be involved in any pathway.
- Interaction of the sensor module of Mycobacterium tuberculosis H37Rv KdpD with members of the Lpr family.
- Mol Microbiol. 2003 Feb;47(4):1075-89.
- Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence.
- Nature. 1998 Jun 11;393(6685):537-44. doi: 10.1038/31159.