gcvH
- Type
- protein_coding
- Name
- gcvH
- Locus Name
-
Rv1826
- Product
-
Probable glycine cleavage system H protein GcvH
- Functional Category
-
Intermediary metabolism and respiration
- Location
- 2071952..2072356 (+ strand)
- Gene Length
- 404 bp
- Nucleotides
-
TGAGCGATATCCCGTCCGATCTGCACTACACCGCCGAACACGAGTGGATTCGCCGCAGTGGCGACGACACCGTCCGGGTGGGGATCACCGACTATGCACAGTCGGCGCTTGGCGACGTCGTTTTCGTTCAGCTACCCGTTATCGGCACCGCGGTCACCGCCGGCGAGACCTTCGGCGAAGTGGAATCGACGAAATCTGTGTCGGATCTCTATGCGCCCATTTCGGGTAAGGTGTCTGAGGTCAACAGCGATCTGGACGGCACTCCGCAATTGGTGAATTCCGACCCCTACGGAGCCGGCTGGCTGCTGGACATCCAGGTCGACAGCTCGGATGTCGCTGCCCTGGAGTCAGCTTTGACGACACTGCTCGACGCTGAGGCCTACCGCGGCACACTGACCGAGTGA
- Drug Resistance
- Mutations
- Function
- The glycine cleavage system catalyzes the degradation of glycine. The H protein shuttles the methylamine group of glycine from the P protein to the T protein. {ECO:0000255|HAMAP-Rule:MF_00272}.
- Family
-
GcvH family
- GO
-
- glycine decarboxylation via glycine cleavage system GO:0019464 biological_process
- glycine cleavage complex GO:0005960 cellular_component
- InterPro
3HGB
- Name
- Glycine cleavage system H protein
- Family
- GcvH family
- Protein Sequence
-
MSDIPSDLHYTAEHEWIRRSGDDTVRVGITDYAQSALGDVVFVQLPVIGTAVTAGETFGEVESTKSVSDLYAPISGKVSEVNSDLDGTPQLVNSDPYGAGWLLDIQVDSSDVAALESALTTLLDAEAYRGTLTE
- Mass
- 14,238 Da
- Length
- 134 Aa
Summary
Rv1826 doesn't seem to be a targeted by any drug.
-
-
Glyoxylate and dicarboxylate metabolism mtu00630
mtu00630PATHWAY_MAP mtu00630 Glyoxylate and dicarboxylate metabolism
-
-
-
Glycine, serine and threonine metabolism mtu00260
mtu00260Metabolism; Amino acid metabolism
-
- Proteogenomic analysis of Mycobacterium tuberculosis by high resolution mass spectrometry.
- Mol Cell Proteomics. 2011 Dec;10(12):M111.011627. doi: 10.1074/mcp.M111.011445. Epub 2011 Oct 3.
- Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence.
- Nature. 1998 Jun 11;393(6685):537-44. doi: 10.1038/31159.