ureG
- Type
- protein_coding
- Name
- ureG
- Locus Name
-
Rv1852
- Product
-
Urease accessory protein UreG
- Functional Category
-
Intermediary metabolism and respiration
- Location
- 2100340..2101014 (+ strand)
- Gene Length
- 674 bp
- Nucleotides
-
TGGCAACGCATTCCCATCCCCACTCGCACACCGTGCCCGCTCGGCCAAGGCGGGTCCGCAAACCGGGCGAGCCACTGCGCATCGGCGTCGGCGGCCCGGTCGGCTCCGGCAAGACCGCACTGGTGGCGGCGCTGTGCCGGCAATTGCGGGGAGAGCTGTCGCTGGCGGTGCTGACCAACGACATCTACACCACCGAAGACGCCGACTTCTTGCGCACACATGCGGTGCTGCCAGACGACCGGATCGCGGCCGTGCAGACCGGCGGCTGCCCGCACACCGCGATCCGCGACGACATCACCGCCAACCTGGATGCGATCGACGAGTTGATGGCCGCCCACGACGCGTTGGACCTGATCCTGGTCGAATCCGGCGGCGATAACCTCACGGCCACCTTCTCTTCGGGGCTGGTGGATGCGCAGATCTTCGTCATTGACGTTGCCGGCGGCGACAAGGTGCCGCGCAAGGGCGGGCCGGGGGTGACCTATTCGGATTTGTTGGTAGTCAACAAGACTGACCTGGCTGCATTGGTGGGCGCCGACCTGGCGGTGATGGCCCGCGATGCGGACGCGGTGCGCGACGGCCGCCCGACGGTGCTGCAATCGTTGACCGAGGACCCAGCTGCCAGCGATGTCGTGGCCTGGGTTCGTAGTCAACTGGCCGCCGATGGAGTCTAG
- Drug Resistance
- Mutations
- Function
- Facilitates the functional incorporation of the urease nickel metallocenter. This process requires GTP hydrolysis, probably effectuated by UreG. {ECO:0000255|HAMAP-Rule:MF_01389}.
- Family
-
SIMIBI class G3E GTPase family, UreG subfamily
- GO
-
- GTPase activity GO:0003924 molecular_function
- GTP binding GO:0005525 molecular_function
- cytoplasm GO:0005737 cellular_component
- nickel cation binding GO:0016151 molecular_function
- nitrogen compound metabolic process GO:0006807 biological_process
- InterPro
Summary
- Name
- Urease accessory protein UreG
- Family
- SIMIBI class G3E GTPase family, UreG subfamily
- Protein Sequence
-
MATHSHPHSHTVPARPRRVRKPGEPLRIGVGGPVGSGKTALVAALCRQLRGELSLAVLTNDIYTTEDADFLRTHAVLPDDRIAAVQTGGCPHTAIRDDITANLDAIDELMAAHDALDLILVESGGDNLTATFSSGLVDAQIFVIDVAGGDKVPRKGGPGVTYSDLLVVNKTDLAALVGADLAVMARDADAVRDGRPTVLQSLTEDPAASDVVAWVRSQLAADGV
- Mass
- 23,348 Da
- Length
- 224 Aa
Rv1852 doesn't seem to be a targeted by any drug.
Rv1852 doesn't seem to be involved in any pathway.
- Proteogenomic analysis of Mycobacterium tuberculosis by high resolution mass spectrometry.
- Mol Cell Proteomics. 2011 Dec;10(12):M111.011627. doi: 10.1074/mcp.M111.011445. Epub 2011 Oct 3.
- Biochemical studies on Mycobacterium tuberculosis UreG and comparative modeling reveal structural and functional conservation among the bacterial UreG family.
- Biochemistry. 2007 Mar 20;46(11):3171-82. doi: 10.1021/bi6024676. Epub 2007 Feb 20.
- Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence.
- Nature. 1998 Jun 11;393(6685):537-44. doi: 10.1038/31159.
- Purification, characterization, and genetic analysis of Mycobacterium tuberculosis urease, a potentially critical determinant of host-pathogen interaction.
- J Bacteriol. 1995 Oct;177(19):5644-52. doi: 10.1128/jb.177.19.5644-5652.1995.