Gene - combatTB X

apa

Type: protein_coding
Name: apa
Locus Name: Rv1860
Product: Alanine and proline rich secreted protein Apa (fibronectin attachment protein) (immunogenic protein MPT32) (antigen MPT-32) (45-kDa glycoprotein) (45/47 kDa antigen)
Functional Category: Cell wall and cell processes
Location: 2107736..2108713 (+ strand)
Gene Length: 977 bp
Nucleotides: TGCATCAGGTGGACCCCAACTTGACACGTCGCAAGGGACGATTGGCGGCACTGGCTATCGCGGCGATGGCCAGCGCCAGCCTGGTGACCGTTGCGGTGCCCGCGACCGCCAACGCCGATCCGGAGCCAGCGCCCCCGGTACCCACAACGGCCGCCTCGCCGCCGTCGACCGCTGCAGCGCCACCCGCACCGGCGACACCTGTTGCCCCCCCACCACCGGCCGCCGCCAACACGCCGAATGCCCAGCCGGGCGATCCCAACGCAGCACCTCCGCCGGCCGACCCGAACGCACCGCCGCCACCTGTCATTGCCCCAAACGCACCCCAACCTGTCCGGATCGACAACCCGGTTGGAGGATTCAGCTTCGCGCTGCCTGCTGGCTGGGTGGAGTCTGACGCCGCCCACTTCGACTACGGTTCAGCACTCCTCAGCAAAACCACCGGGGACCCGCCATTTCCCGGACAGCCGCCGCCGGTGGCCAATGACACCCGTATCGTGCTCGGCCGGCTAGACCAAAAGCTTTACGCCAGCGCCGAAGCCACCGACTCCAAGGCCGCGGCCCGGTTGGGCTCGGACATGGGTGAGTTCTATATGCCCTACCCGGGCACCCGGATCAACCAGGAAACCGTCTCGCTCGACGCCAACGGGGTGTCTGGAAGCGCGTCGTATTACGAAGTCAAGTTCAGCGATCCGAGTAAGCCGAACGGCCAGATCTGGACGGGCGTAATCGGCTCGCCCGCGGCGAACGCACCGGACGCCGGGCCCCCTCAGCGCTGGTTTGTGGTATGGCTCGGGACCGCCAACAACCCGGTGGACAAGGGCGCGGCCAAGGCGCTGGCCGAATCGATCCGGCCTTTGGTCGCCCCGCCGCCGGCGCCGGCACCGGCTCCTGCAGAGCCCGCTCCGGCGCCGGCGCCGGCCGGGGAAGTCGCTCCTACCCCGACGACACCGACACCGCAGCGGACCTTACCGGCCTGA
Drug Resistance: Check for drug resistance association at TBDREAMDB
Mutations: Check for mutants available at TARGET

Function

A potent antigen in animals immunized with live bacteria, it induces a strong delayed-type hypersensitivity (DTH) in immunized animals (PubMed:10531201). Elicits a mostly Th1 type of T-cell response in healthy humans; induces IFN-gamma production from CD4(+) and CD8(+) cells (PubMed:12654810). Functions as an adhesin, binds to mouse macrophages via mannose residues (PubMed:10531201, PubMed:25359607). Might interact via host CD209 (PubMed:16092920). {ECO:0000269|PubMed:10531201, ECO:0000269|PubMed:12654810, ECO:0000269|PubMed:16092920, ECO:0000269|PubMed:25359607}.

Family

Apa family

GO

cell surface GO:0009986 cellular_component
cellular response to starvation GO:0009267 biological_process
extracellular region GO:0005576 cellular_component
induction by symbiont of host immune response GO:0052559 biological_process
extracellular matrix binding GO:0050840 molecular_function

InterPro

IPR010801

UniProt: P9WIR7
GenBank: Rv1860
EnsemblBacteria: Rv1860
Mycobrowser: Rv1860

Summary

Name: Alanine and proline-rich secreted protein Apa (45 kDa glycoprotein) (45/47 kDa antigen) (Antigen MPT-32) (FAP-B) (Fibronectin attachment protein) (Immunogenic protein MPT32)
Family: Apa family
Protein Sequence: MHQVDPNLTRRKGRLAALAIAAMASASLVTVAVPATANADPEPAPPVPTTAASPPSTAAAPPAPATPVAPPPPAAANTPNAQPGDPNAAPPPADPNAPPPPVIAPNAPQPVRIDNPVGGFSFALPAGWVESDAAHFDYGSALLSKTTGDPPFPGQPPPVANDTRIVLGRLDQKLYASAEATDSKAAARLGSDMGEFYMPYPGTRINQETVSLDANGVSGSASYYEVKFSDPSKPNGQIWTGVIGSPAANAPDAGPPQRWFVVWLGTANNPVDKGAAKALAESIRPLVAPPPAPAPAPAEPAPAPAPAGEVAPTPTTPTPQRTLPA
Mass: 32,721 Da
Length: 325 Aa

Rv1860 doesn't seem to be a targeted by any drug.

Rv1860 doesn't seem to be involved in any pathway.

PstS-1, the 38-kDa Mycobacterium tuberculosis glycoprotein, is an adhesin, which binds the macrophage mannose receptor and promotes phagocytosis.: Scand J Immunol. 2015 Jan;81(1):46-55. doi: 10.1111/sji.12249.
Proteogenomic analysis of Mycobacterium tuberculosis by high resolution mass spectrometry.: Mol Cell Proteomics. 2011 Dec;10(12):M111.011627. doi: 10.1074/mcp.M111.011445. Epub 2011 Oct 3.
Deciphering the molecular bases of Mycobacterium tuberculosis binding to the lectin DC-SIGN reveals an underestimated complexity.: Biochem J. 2005 Dec 15;392(Pt 3):615-24. doi: 10.1042/BJ20050709.
The Apa protein of Mycobacterium tuberculosis stimulates gamma interferon-secreting CD4+ and CD8+ T cells from purified protein derivative-positive individuals and affords protection in a guinea pig model.: Infect Immun. 2003 Apr;71(4):1929-37. doi: 10.1128/iai.71.4.1929-1937.2003.
Deglycosylation of the 45/47-kilodalton antigen complex of Mycobacterium tuberculosis decreases its capacity to elicit in vivo or in vitro cellular immune responses.: Infect Immun. 1999 Nov;67(11):5567-72.
Decreased capacity of recombinant 45/47-kDa molecules (Apa) of Mycobacterium tuberculosis to stimulate T lymphocyte responses related to changes in their mannosylation pattern.: J Biol Chem. 1999 Nov 5;274(45):32023-30. doi: 10.1074/jbc.274.45.32023.
Definition of the full extent of glycosylation of the 45-kilodalton glycoprotein of Mycobacterium tuberculosis.: J Bacteriol. 1996 May;178(9):2498-506. doi: 10.1128/jb.178.9.2498-2506.1996.
Evidence for glycosylation sites on the 45-kilodalton glycoprotein of Mycobacterium tuberculosis.: Infect Immun. 1995 Aug;63(8):2846-53.
Isolation and partial characterization of major protein antigens in the culture fluid of Mycobacterium tuberculosis.: Infect Immun. 1991 Jan;59(1):372-82.
Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence.: Nature. 1998 Jun 11;393(6685):537-44. doi: 10.1038/31159.
Cloning, sequencing, and expression of the apa gene coding for the Mycobacterium tuberculosis 45/47-kilodalton secreted antigen complex.: Infect Immun. 1995 Oct;63(10):4003-10.