Rv2060
- Type
- protein_coding
- Name
- Rv2060
- Locus Name
-
Rv2060
- Product
-
Possible conserved integral membrane protein
- Functional Category
-
Cell wall and cell processes
- Location
- 2316279..2316680 (+ strand)
- Gene Length
- 401 bp
- Nucleotides
-
TGCTGACCGTGGTTTGTCTGCTCGTGGTCACCGTGTTGGCGATCTGCTACCGACCGCTCTTGTTTGCCACCGTCGATCCGGAGGTCGCGGCCGCCCGCGGCGTGCCAGTGCGCGCCCTGGGAATTGTGTTCGCCGCACTGATGGGCGTGGTAGCCGCCCAGGCTGTCCAGATCGTCGGGGCACTCCTCGTGATGTCTTTGCTGATCACCCCCGCCGCGGCGGCCGCCCGGGTCGTGGTTGCCCCGGTCGCCGCGATCGCGACCTCGGTGGTCTTCGCCGAGGTTTCCGCCGTCGGCGGCATCCTGCTGTCGCTGGCGCCTGGAGTCCCGGTGTCGGTGTTCGTGGCCACCATCTCGTTTGTGATCTACCTGATTTGCTGGTTGCTCCGGCGGCGCCGCTAA
- Drug Resistance
- Mutations
- Function
- Unknown
- Family
-
ABC-3 integral membrane protein family
- GO
-
- response to zinc ion GO:0010043 biological_process
- extracellular region GO:0005576 cellular_component
- integral component of plasma membrane GO:0005887 cellular_component
- ATPase-coupled transmembrane transporter activity GO:0042626 molecular_function
- ATP-binding cassette (ABC) transporter complex GO:0043190 cellular_component
- plasma membrane GO:0005886 cellular_component
- InterPro
Summary
- Name
- Possible conserved integral membrane protein
- Family
- ABC-3 integral membrane protein family
- Protein Sequence
-
MLTVVCLLVVTVLAICYRPLLFATVDPEVAAARGVPVRALGIVFAALMGVVAAQAVQIVGALLVMSLLITPAAAAARVVVAPVAAIATSVVFAEVSAVGGILLSLAPGVPVSVFVATISFVIYLICWLLRRRR
- Mass
- 13,665 Da
- Length
- 133 Aa
Rv2060 doesn't seem to be a targeted by any drug.
Rv2060 doesn't seem to be involved in any pathway.
- Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence.
- Nature. 1998 Jun 11;393(6685):537-44. doi: 10.1038/31159.