sigC
- Type
- protein_coding
- Name
- sigC
- Locus Name
-
Rv2069
- Product
-
RNA polymerase sigma factor, ECF subfamily, SigC
- Functional Category
-
Information pathways
- Location
- 2326944..2327501 (+ strand)
- Gene Length
- 557 bp
- Nucleotides
-
TGACCGCGACGGCAAGCGACGACGAGGCCGTTACCGCACTCGCCTTGTCGGCGGCCAAGGGGAACGGGCGGGCCCTTGAGGCGTTTATCAAAGCCACCCAGCAAGACGTGTGGCGGTTCGTCGCCTATCTGTCCGACGTGGGCAGTGCGGACGATCTCACCCAAGAGACATTCCTACGAGCGATCGGCGCCATCCCGCGGTTTTCCGCACGCTCCAGCGCCCGAACTTGGTTGCTGGCCATCGCGCGCCATGTCGTCGCCGATCACATCCGCCACGTCCGATCCCGGCCCCGCACCACCCGCGGCGCGCGTCCCGAACATCTCATAGACGGCGACCGCCATGCCCGCGGATTCGAAGACCTCGTCGAGGTAACCACGATGATCGCCGACCTAACCACCGACCAACGGGAAGCGCTGCTGCTGACCCAGCTGCTCGGGCTGTCCTATGCGGACGCCGCGGCGGTGTGCGGCTGCCCGGTGGGCACCATCCGATCCCGTGTCGCTCGAGCGCGCGATGCGCTGCTTGCCGACGCGGAGCCCGACGACCTCACCGGCTAG
- Drug Resistance
- Mutations
- Function
- Sigma factors are initiation factors that promote the attachment of RNA polymerase to specific initiation sites and are then released. Extracytoplasmic function (ECF) sigma factors are usually held in an inactive form by an anti-sigma factor until released by regulated intramembrane proteolysis; this sigma factor does not seem to have a cognate anti-sigma factor however. It has been suggested that the sigma domains 2 and 4 may interact via polar residues in this protein to autoregulate. Positively regulates expression of a small regulon of genes.
- Family
-
Sigma-70 factor family, ECF subfamily
- GO
-
- sigma factor activity GO:0016987 molecular_function
- response to hypoxia GO:0001666 biological_process
- regulation of transcription, DNA-templated GO:0006355 biological_process
- DNA-templated transcription, initiation GO:0006352 biological_process
- DNA binding GO:0003677 molecular_function
- DNA-binding transcription factor activity GO:0003700 molecular_function
- pathogenesis GO:0009405 biological_process
- response to xenobiotic stimulus GO:0009410 biological_process
- response to water GO:0009415 biological_process
- response to heat GO:0009408 biological_process
- InterPro
2O7G
- Name
- ECF RNA polymerase sigma factor SigC (ECF sigma factor SigC) (Alternative RNA polymerase sigma factor SigC) (RNA polymerase sigma-C factor) (Sigma-C factor)
- Family
- Sigma-70 factor family, ECF subfamily
- Protein Sequence
-
MTATASDDEAVTALALSAAKGNGRALEAFIKATQQDVWRFVAYLSDVGSADDLTQETFLRAIGAIPRFSARSSARTWLLAIARHVVADHIRHVRSRPRTTRGARPEHLIDGDRHARGFEDLVEVTTMIADLTTDQREALLLTQLLGLSYADAAAVCGCPVGTIRSRVARARDALLADAEPDDLTG
- Mass
- 19,966 Da
- Length
- 185 Aa
Summary
Rv2069 doesn't seem to be a targeted by any drug.
Rv2069 doesn't seem to be involved in any pathway.
- Structural and biophysical studies on two promoter recognition domains of the extra-cytoplasmic function sigma factor sigma(C) from Mycobacterium tuberculosis.
- J Biol Chem. 2007 Feb 16;282(7):4711-8. doi: 10.1074/jbc.M606283200. Epub 2006 Dec 4.
- Mycobacterium tuberculosis H37Rv sigC is expressed from two promoters but is not auto-regulatory.
- Tuberculosis (Edinb). 2012 Jan;92(1):48-55. doi: 10.1016/j.tube.2011.09.005. Epub 2011 Oct 19.
- Experimental determination of translational start sites resolves uncertainties in genomic open reading frame predictions - application to Mycobacterium tuberculosis.
- Microbiology. 2009 Jan;155(Pt 1):186-97. doi: 10.1099/mic.0.022889-0.
- targetTB: a target identification pipeline for Mycobacterium tuberculosis through an interactome, reactome and genome-scale structural analysis.
- BMC Syst Biol. 2008 Dec 19;2:109. doi: 10.1186/1752-0509-2-109.
- Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence.
- Nature. 1998 Jun 11;393(6685):537-44. doi: 10.1038/31159.
- Differential expression of 10 sigma factor genes in Mycobacterium tuberculosis.
- Mol Microbiol. 1999 Jan;31(2):715-24.
- Examination of Mycobacterium tuberculosis sigma factor mutants using low-dose aerosol infection of guinea pigs suggests a role for SigC in pathogenesis.
- Microbiology. 2006 Jun;152(Pt 6):1591-600. doi: 10.1099/mic.0.28591-0.