prcA



Type
protein_coding
Name
prcA
Locus Name

Rv2109c

Product

Proteasome alpha subunit PrcA; assembles with beta subunit PrcB.

Functional Category

Intermediary metabolism and respiration

Location
2368983..2369729 (- strand)
Gene Length
746 bp
Nucleotides
GTGAGTTTTCCGTATTTCATCTCGCCTGAGCAGGCGATGCGCGAGCGCAGCGAGTTGGCGCGTAAGGGCATTGCGCGGGCCAAAAGCGTGGTGGCGCTGGCCTATGCCGGTGGTGTGCTGTTCGTCGCGGAGAATCCGTCGCGGTCGCTGCAGAAGATCAGTGAGCTCTACGATCGGGTGGGTTTTGCGGCTGCGGGCAAGTTCAACGAGTTCGACAATTTGCGCCGCGGCGGGATCCAGTTCGCCGACACCCGCGGTTACGCCTATGACCGTCGTGACGTCACGGGTCGGCAGTTGGCCAATGTCTACGCGCAGACTCTAGGCACCATCTTCACCGAACAGGCCAAGCCCTACGAGGTTGAGTTGTGTGTGGCCGAGGTGGCGCATTACGGCGAGACGAAACGCCCTGAGTTGTATCGTATTACCTACGACGGGTCGATCGCCGACGAGCCGCATTTCGTGGTGATGGGCGGCACCACGGAGCCGATCGCCAACGCGCTCAAAGAGTCGTATGCCGAGAACGCCAGCCTGACCGACGCCCTGCGTATCGCGGTCGCTGCATTGCGGGCCGGCAGTGCCGACACCTCGGGTGGTGATCAACCCACCCTTGGCGTGGCCAGCTTAGAGGTGGCCGTTCTCGATGCCAACCGGCCACGGCGCGCGTTCCGGCGCATCACCGGCTCCGCCCTGCAAGCGTTGCTGGTAGACCAGGAAAGCCCGCAGTCTGACGGCGAATCGTCGGGCTG
Drug Resistance

Check for drug resistance association at TBDREAMDB

Mutations

Check for mutants available at TARGET


Function
Component of the proteasome core, a large protease complex with broad specificity involved in protein degradation. The M.tuberculosis proteasome is able to cleave oligopeptides not only after hydrophobic but also after basic, acidic and small neutral residues (PubMed:16468985). In complex with the ATPase Mpa, degrades protein targets conjugated to a prokaryotic ubiquitin-like protein (Pup). Among the identified substrates of the M.tuberculosis proteasome are the pupylated FabD, PanB and Mpa proteins (PubMed:17082771). One function of the proteasome is to contribute to M.tuberculosis ability to resist killing by host macrophages, since the core proteasome is essential for persistence of the pathogen during the chronic phase of infection in mice (PubMed:18059281). Likely functions to recycle amino acids under nutrient starvation, thereby enabling the cell to maintain basal metabolic activities (PubMed:20711362) (By similarity). The mechanism of protection against bactericidal chemistries of the host's immune response probably involves the degradation of proteins that are irreversibly oxidized, nitrated, or nitrosated. A proteolysis-independent activity of the proteasome core is required for optimal growth of M.tuberculosis in mouse lungs and for RNI resistance; in contrast, long-term survival of M.tuberculosis in stationary phase and during starvation in vitro and in the chronic phase of mouse infection required a proteolytically active proteasome (PubMed:20711362). {ECO:0000250|UniProtKB:A0QZ46, ECO:0000255|HAMAP-Rule:MF_00289, ECO:0000269|PubMed:16468985, ECO:0000269|PubMed:17082771, ECO:0000269|PubMed:18059281, ECO:0000269|PubMed:20711362}.
Family

Peptidase T1A family

GO
InterPro

UniProt
P9WHU1
GenBank
Rv2109c
EnsemblBacteria
Rv2109c
Mycobrowser
Rv2109c


2FHG
Summary
Name
Proteasome subunit alpha (EC 3.4.25.1) (20S proteasome alpha subunit) (Proteasome core protein PrcA)
Family
Peptidase T1A family
Protein Sequence
MSFPYFISPEQAMRERSELARKGIARAKSVVALAYAGGVLFVAENPSRSLQKISELYDRVGFAAAGKFNEFDNLRRGGIQFADTRGYAYDRRDVTGRQLANVYAQTLGTIFTEQAKPYEVELCVAEVAHYGETKRPELYRITYDGSIADEPHFVVMGGTTEPIANALKESYAENASLTDALRIAVAALRAGSADTSGGDQPTLGVASLEVAVLDANRPRRAFRRITGSALQALLVDQESPQSDGESSG
Mass
26,881 Da
Length
248 Aa

Rv2109c doesn't seem to be a targeted by any drug.


Rv2109c doesn't seem to be involved in any pathway.


Structural basis for the assembly and gate closure mechanisms of the Mycobacterium tuberculosis 20S proteasome.
EMBO J. 2010 Jun 16;29(12):2037-47. doi: 10.1038/emboj.2010.95. Epub 2010 May 11.
Fellutamide B is a potent inhibitor of the Mycobacterium tuberculosis proteasome.
Arch Biochem Biophys. 2010 Sep 15;501(2):214-20. doi: 10.1016/j.abb.2010.06.009. Epub 2010 Jun 15.
Inhibitors selective for mycobacterial versus human proteasomes.
Nature. 2009 Oct 1;461(7264):621-6. doi: 10.1038/nature08357. Epub 2009 Sep 16.
Structure of the Mycobacterium tuberculosis proteasome and mechanism of inhibition by a peptidyl boronate.
Mol Microbiol. 2006 Mar;59(5):1417-28. doi: 10.1111/j.1365-2958.2005.05036.x.
Bacterial proteasome activator bpa (rv3780) is a novel ring-shaped interactor of the mycobacterial proteasome.
PLoS One. 2014 Dec 3;9(12):e114348. doi: 10.1371/journal.pone.0114348. eCollection 2014.
Phosphorylation regulates mycobacterial proteasome.
J Microbiol. 2014 Sep;52(9):743-54. doi: 10.1007/s12275-014-4416-2. Epub 2014 Sep 2.
The Mycobacterium tuberculosis proteasome active site threonine is essential for persistence yet dispensable for replication and resistance to nitric oxide.
PLoS Pathog. 2010 Aug 12;6(8):e1001040. doi: 10.1371/journal.ppat.1001040.
Stoichiometric protein complex formation and over-expression using the prokaryotic native operon structure.
FEBS Lett. 2010 Feb 19;584(4):669-74. doi: 10.1016/j.febslet.2009.12.057. Epub 2010 Jan 18.
Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence.
Nature. 1998 Jun 11;393(6685):537-44. doi: 10.1038/31159.
Mycobacterium tuberculosis prcBA genes encode a gated proteasome with broad oligopeptide specificity.
Mol Microbiol. 2006 Mar;59(5):1405-16. doi: 10.1111/j.1365-2958.2005.05035.x.
Identification of substrates of the Mycobacterium tuberculosis proteasome.
EMBO J. 2006 Nov 15;25(22):5423-32. doi: 10.1038/sj.emboj.7601405. Epub 2006 Nov 2.
Experimental determination of translational starts using peptide mass mapping and tandem mass spectrometry within the proteome of Mycobacterium tuberculosis.
Microbiology. 2007 Feb;153(Pt 2):521-8. doi: 10.1099/mic.0.2006/001537-0.
In vivo gene silencing identifies the Mycobacterium tuberculosis proteasome as essential for the bacteria to persist in mice.
Nat Med. 2007 Dec;13(12):1515-20. doi: 10.1038/nm1683. Epub 2007 Dec 2.
targetTB: a target identification pipeline for Mycobacterium tuberculosis through an interactome, reactome and genome-scale structural analysis.
BMC Syst Biol. 2008 Dec 19;2:109. doi: 10.1186/1752-0509-2-109.
Proteogenomic analysis of Mycobacterium tuberculosis by high resolution mass spectrometry.
Mol Cell Proteomics. 2011 Dec;10(12):M111.011627. doi: 10.1074/mcp.M111.011445. Epub 2011 Oct 3.