Gene - combatTB X

wag31

Type: protein_coding
Name: wag31
Locus Name: Rv2145c
Product: Diviva family protein Wag31
Functional Category: Cell wall and cell processes
Location: 2404616..2405398 (- strand)
Gene Length: 782 bp
Nucleotides: ATGCCGCTTACACCTGCCGACGTCCACAATGTGGCGTTCAGTAAGCCGCCTATCGGCAAACGTGGGTACAACGAAGATGAGGTCGACGCCTTCCTCGACCTGGTGGAAAACGAGCTGACCCGCCTGATCGAAGAGAACTCCGATCTGCGTCAGAGGATCAACGAGCTGGATCAAGAGCTCGCCGCGGGCGGCGGTGCCGGCGTTACGCCGCAGGCCACCCAGGCAATCCCGGCGTATGAGCCCGAACCGGGCAAGCCGGCGCCGGCGGCGGTCTCGGCGGGGATGAACGAGGAACAGGCCCTGAAGGCGGCGCGAGTGCTGAGTCTGGCCCAAGACACCGCCGACCGGCTTACAAACACCGCCAAAGCCGAGTCGGACAAGATGCTGGCCGATGCCCGTGCCAATGCGGAGCAGATCCTCGGTGAGGCCCGACACACCGCCGACGCCACGGTCGCCGAGGCCCGCCAGCGTGCCGATGCCATGCTGGCCGATGCCCAATCCCGATCCGAGGCCCAGTTGCGCCAGGCGCAGGAGAAGGCCGATGCCTTACAGGCCGATGCGGAACGCAAGCACTCCGAGATCATGGGAACCATCAACCAGCAGCGCGCGGTGCTTGAAGGCCGCCTCGAGCAGCTGCGTACCTTCGAACGTGAGTACCGCACCAGGCTCAAGACCTACCTGGAATCGCAGCTGGAGGAACTCGGCCAGCGTGGATCGGCGGCGCCGGTCGATTCCAATGCGGATGCCGGTGGCTTCGATCAATTCAACCGGGGCAAAAACTA
Drug Resistance: Check for drug resistance association at TBDREAMDB
Mutations: Check for mutants available at TARGET

Function

Important for maintaining cell shape and cell wall integrity by localizing peptidoglycan synthesis to the cell poles. Protects PbpB (PBP3, FtsI) from oxidative stress-induced cleavage. {ECO:0000269|PubMed:18310019, ECO:0000269|PubMed:19496931, ECO:0000269|PubMed:21190553}.

Family

DivIVA family

GO

cell division GO:0051301 biological_process
protein stabilization GO:0050821 biological_process
cell pole GO:0060187 cellular_component
cytoplasm GO:0005737 cellular_component
plasma membrane GO:0005886 cellular_component
regulation of cell shape GO:0008360 biological_process
cell wall GO:0005618 cellular_component
regulation of growth rate GO:0040009 biological_process
peptidoglycan-based cell wall biogenesis GO:0009273 biological_process
cell cycle GO:0007049 biological_process

InterPro

UniProt: P9WMU1
GenBank: Rv2145c
EnsemblBacteria: Rv2145c
Mycobrowser: Rv2145c

Summary

Name: Cell wall synthesis protein Wag31 (Antigen 84)
Family: DivIVA family
Protein Sequence: MPLTPADVHNVAFSKPPIGKRGYNEDEVDAFLDLVENELTRLIEENSDLRQRINELDQELAAGGGAGVTPQATQAIPAYEPEPGKPAPAAVSAGMNEEQALKAARVLSLAQDTADRLTNTAKAESDKMLADARANAEQILGEARHTADATVAEARQRADAMLADAQSRSEAQLRQAQEKADALQADAERKHSEIMGTINQQRAVLEGRLEQLRTFEREYRTRLKTYLESQLEELGQRGSAAPVDSNADAGGFDQFNRGKN
Mass: 28,277 Da
Length: 260 Aa

Rv2145c doesn't seem to be a targeted by any drug.

Rv2145c doesn't seem to be involved in any pathway.

Mycobacterium tuberculosis CwsA interacts with CrgA and Wag31, and the CrgA-CwsA complex is involved in peptidoglycan synthesis and cell shape determination.: J Bacteriol. 2012 Dec;194(23):6398-409. doi: 10.1128/JB.01005-12. Epub 2012 Sep 21.
Proteogenomic analysis of Mycobacterium tuberculosis by high resolution mass spectrometry.: Mol Cell Proteomics. 2011 Dec;10(12):M111.011627. doi: 10.1074/mcp.M111.011445. Epub 2011 Oct 3.
The wag31 gene of Mycobacterium tuberculosis is positively regulated by the stringent response.: FEMS Microbiol Lett. 2011 Jun;319(2):153-9. doi: 10.1111/j.1574-6968.2011.02278.x. Epub 2011 May 6.
Regulation of polar peptidoglycan biosynthesis by Wag31 phosphorylation in mycobacteria.: BMC Microbiol. 2010 Dec 29;10:327. doi: 10.1186/1471-2180-10-327.
Molecular and immunological characterization of the highly conserved antigen 84 from Mycobacterium tuberculosis and Mycobacterium leprae.: Infect Immun. 1995 Mar;63(3):954-60.
Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence.: Nature. 1998 Jun 11;393(6685):537-44. doi: 10.1038/31159.
The Mycobacterium tuberculosis serine/threonine kinases PknA and PknB: substrate identification and regulation of cell shape.: Genes Dev. 2005 Jul 15;19(14):1692-704. doi: 10.1101/gad.1311105. Epub 2005 Jun 28.
targetTB: a target identification pipeline for Mycobacterium tuberculosis through an interactome, reactome and genome-scale structural analysis.: BMC Syst Biol. 2008 Dec 19;2:109. doi: 10.1186/1752-0509-2-109.
Wag31, a homologue of the cell division protein DivIVA, regulates growth, morphology and polar cell wall synthesis in mycobacteria.: Microbiology. 2008 Mar;154(Pt 3):725-35. doi: 10.1099/mic.0.2007/014076-0.
Novel role of Wag31 in protection of mycobacteria under oxidative stress.: Mol Microbiol. 2009 Jul;73(1):103-19. doi: 10.1111/j.1365-2958.2009.06750.x. Epub 2009 Jun 1.