Rv2147c
- Type
- protein_coding
- Name
- Rv2147c
- Locus Name
-
Rv2147c
- Product
-
Conserved hypothetical protein
- Functional Category
-
Conserved hypotheticals
- Location
- 2406118..2406843 (- strand)
- Gene Length
- 725 bp
- Nucleotides
-
GTGAATAGTCACTGTAGTCACACCTTCATCACAGACAACAGATCTCCCAGGGCTAGAAGGGGTCACGCAATGAGCACACTGCACAAGGTCAAGGCCTACTTCGGTATGGCTCCCATGGAGGATTACGACGACGAGTACTACGACGACCGCGCTCCCTCGCGCGGGTATGCGCGGCCCCGATTCGACGACGACTACGGCCGCTACGATGGGCGCGACTACGACGACGCGCGCAGCGATTCACGCGGTGACCTGCGCGGTGAGCCGGCCGACTATCCACCACCGGGATATCGCGGCGGGTACGCGGACGAACCACGTTTCCGGCCCCGGGAGTTCGACCGCGCGGAGATGACACGGCCGCGCTTCGGATCGTGGCTGCGCAACTCCACCCGCGGCGCGCTAGCGATGGACCCCCGCCGGATGGCGATGATGTTCGAGGATGGCCATCCGCTCTCGAAGATCACCACGCTGCGGCCCAAGGACTACAGCGAGGCTCGCACCATCGGTGAGCGGTTCCGCGACGGCAGCCCGGTCATCATGGATCTGGTGTCGATGGACAACGCCGATGCCAAGCGGCTGGTCGATTTCGCGGCCGGCCTGGCCTTCGCGCTGCGCGGCTCGTTCGACAAGGTCGCGACCAAGGTGTTCCTGCTCTCGCCTGCAGACGTCGATGTGTCCCCCGAGGAGCGCCGCAGGATCGCCGAAACCGGGTTCTACGCCTACCAATA
- Drug Resistance
- Mutations
- Function
- Cell division protein that is part of the divisome complex and is recruited early to the Z-ring. Probably stimulates Z-ring formation, perhaps through the cross-linking of FtsZ protofilaments. Its function overlaps with FtsA. {ECO:0000255|HAMAP-Rule:MF_01197}.
- Family
-
SepF family
- GO
-
- division septum assembly GO:0000917 biological_process
- FtsZ-dependent cytokinesis GO:0043093 biological_process
- plasma membrane GO:0005886 cellular_component
- cytoplasm GO:0005737 cellular_component
- InterPro
Summary
- Name
- Cell division protein SepF
- Family
- SepF family
- Protein Sequence
-
MSTLHKVKAYFGMAPMEDYDDEYYDDRAPSRGYARPRFDDDYGRYDGRDYDDARSDSRGDLRGEPADYPPPGYRGGYADEPRFRPREFDRAEMTRPRFGSWLRNSTRGALAMDPRRMAMMFEDGHPLSKITTLRPKDYSEARTIGERFRDGSPVIMDLVSMDNADAKRLVDFAAGLAFALRGSFDKVATKVFLLSPADVDVSPEERRRIAETGFYAYQ
- Mass
- 25,028 Da
- Length
- 218 Aa
Rv2147c doesn't seem to be a targeted by any drug.
Rv2147c doesn't seem to be involved in any pathway.
- Proteogenomic analysis of Mycobacterium tuberculosis by high resolution mass spectrometry.
- Mol Cell Proteomics. 2011 Dec;10(12):M111.011627. doi: 10.1074/mcp.M111.011445. Epub 2011 Oct 3.
- Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence.
- Nature. 1998 Jun 11;393(6685):537-44. doi: 10.1038/31159.