ftsZ
- Type
- protein_coding
- Name
- ftsZ
- Locus Name
-
Rv2150c
- Product
-
Cell division protein FtsZ
- Functional Category
-
Cell wall and cell processes
- Location
- 2408385..2409524 (- strand)
- Gene Length
- 1139 bp
- Nucleotides
-
ATGACCCCCCCGCACAACTACCTGGCCGTCATCAAGGTCGTGGGTATCGGTGGTGGCGGTGTCAACGCCGTCAACCGAATGATCGAGCAGGGCCTCAAAGGCGTGGAATTCATCGCGATCAACACCGACGCCCAGGCGTTGTTGATGAGCGATGCCGACGTCAAACTCGACGTCGGCCGCGACTCCACCCGCGGGCTGGGCGCCGGCGCCGATCCGGAGGTCGGCCGTAAGGCCGCCGAGGACGCCAAGGACGAGATCGAAGAGCTGCTGCGCGGTGCCGACATGGTGTTTGTCACCGCCGGCGAGGGGGGCGGAACCGGCACCGGGGGGGCACCCGTCGTCGCCAGCATCGCCCGCAAGCTGGGCGCGTTGACCGTCGGTGTGGTCACCCGGCCGTTCTCGTTCGAGGGCAAGCGACGCAGCAATCAGGCCGAAAATGGCATCGCGGCGCTGCGGGAGAGTTGCGACACCCTCATCGTGATTCCCAACGACCGGTTGCTGCAGATGGGAGATGCCGCGGTATCGCTGATGGATGCTTTCCGTAGCGCCGACGAGGTGCTGCTCAACGGCGTGCAGGGCATCACCGACCTGATTACCACCCCGGGTCTAATCAACGTCGACTTCGCCGACGTCAAGGGCATCATGTCCGGTGCCGGCACCGCACTGATGGGCATCGGCTCGGCCCGGGGCGAAGGCCGGTCGCTCAAAGCGGCCGAGATCGCCATCAACTCGCCGTTGCTGGAAGCCTCGATGGAGGGCGCGCAAGGCGTGCTGATGTCGATCGCCGGCGGCAGCGACTTGGGCTTGTTCGAGATCAACGAGGCGGCCTCGTTGGTACAAGACGCCGCTCACCCCGATGCCAACATCATCTTCGGCACCGTCATCGACGATTCGCTCGGTGACGAGGTGCGGGTGACCGTGATCGCGGCCGGCTTCGACGTCAGCGGTCCCGGCCGCAAGCCGGTGATGGGCGAGACCGGCGGCGCCCACCGGATCGAGTCAGCCAAGGCAGGCAAGCTCACCTCGACCTTGTTCGAGCCGGTCGACGCCGTCAGCGTGCCGTTGCACACCAACGGCGCAACCCTGAGCATCGGCGGTGATGACGACGATGTCGACGTGCCGCCCTTCATGCGCCGCTG
- Drug Resistance
- Mutations
- Function
- Essential cell division protein that forms a contractile ring structure (Z ring) at the future cell division site. The regulation of the ring assembly controls the timing and the location of cell division. One of the functions of the FtsZ ring is to recruit other cell division proteins to the septum to produce a new cell wall between the dividing cells. Binds GTP and shows GTPase activity. {ECO:0000255|HAMAP-Rule:MF_00909}.
- Family
-
FtsZ family
- GO
-
- cell division site GO:0032153 cellular_component
- magnesium ion binding GO:0000287 molecular_function
- septin ring assembly GO:0000921 biological_process
- division septum assembly GO:0000917 biological_process
- GTPase activity GO:0003924 molecular_function
- FtsZ-dependent cytokinesis GO:0043093 biological_process
- GTP binding GO:0005525 molecular_function
- plasma membrane GO:0005886 cellular_component
- cytoplasm GO:0005737 cellular_component
- positive regulation of cell cycle GO:0045787 biological_process
- cell division GO:0051301 biological_process
- protein polymerization GO:0051258 biological_process
- InterPro
1RLU
- Name
- Cell division protein FtsZ
- Family
- FtsZ family
- Protein Sequence
-
MTPPHNYLAVIKVVGIGGGGVNAVNRMIEQGLKGVEFIAINTDAQALLMSDADVKLDVGRDSTRGLGAGADPEVGRKAAEDAKDEIEELLRGADMVFVTAGEGGGTGTGGAPVVASIARKLGALTVGVVTRPFSFEGKRRSNQAENGIAALRESCDTLIVIPNDRLLQMGDAAVSLMDAFRSADEVLLNGVQGITDLITTPGLINVDFADVKGIMSGAGTALMGIGSARGEGRSLKAAEIAINSPLLEASMEGAQGVLMSIAGGSDLGLFEINEAASLVQDAAHPDANIIFGTVIDDSLGDEVRVTVIAAGFDVSGPGRKPVMGETGGAHRIESAKAGKLTSTLFEPVDAVSVPLHTNGATLSIGGDDDDVDVPPFMRR
- Mass
- 38,756 Da
- Length
- 379 Aa
Summary
- Citric Acid DB04272
-
2-Hydroxytricarballylic acid | 3-Carboxy-3-hydroxypentane-1,5-dioic acid | Citric Acid, Anhydrous | Citronensäure
Rv2150c doesn't seem to be involved in any pathway.
- FtsZ protofilaments use a hinge-opening mechanism for constrictive force generation.
- Science. 2013 Jul 26;341(6144):392-5. doi: 10.1126/science.1239248.
- Characterizing septum inhibition in Mycobacterium tuberculosis for novel drug discovery.
- Tuberculosis (Edinb). 2008 Sep;88(5):420-9. doi: 10.1016/j.tube.2008.03.001. Epub 2008 May 13.
- Structure of Mycobacterium tuberculosis FtsZ reveals unexpected, G protein-like conformational switches.
- J Mol Biol. 2004 Sep 17;342(3):953-70. doi: 10.1016/j.jmb.2004.07.061.
- Proteogenomic analysis of Mycobacterium tuberculosis by high resolution mass spectrometry.
- Mol Cell Proteomics. 2011 Dec;10(12):M111.011627. doi: 10.1074/mcp.M111.011445. Epub 2011 Oct 3.
- Novel role of phosphorylation-dependent interaction between FtsZ and FipA in mycobacterial cell division.
- PLoS One. 2010 Jan 6;5(1):e8590. doi: 10.1371/journal.pone.0008590.
- Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence.
- Nature. 1998 Jun 11;393(6685):537-44. doi: 10.1038/31159.