lipB
- Type
- protein_coding
- Name
- lipB
- Locus Name
-
Rv2217
- Product
-
Probable lipoate biosynthesis protein B LipB
- Functional Category
-
Intermediary metabolism and respiration
- Location
- 2484584..2485276 (+ strand)
- Gene Length
- 692 bp
- Nucleotides
-
TGACGGGTTCTATCCGGTCGAAGCTGTCCGCGATCGACGTCCGCCAGCTGGGGACCGTCGACTACCGGACCGCGTGGCAGCTACAGCGAGAGCTAGCCGACGCCCGGGTCGCCGGCGGCGCCGACACGCTGCTGCTGTTGGAACACCCCGCGGTCTACACCGCCGGACGGCGTACCGAGACACACGAGCGACCCATTGACGGCACTCCGGTCGTCGACACCGACCGCGGCGGCAAGATCACCTGGCACGGTCCGGGGCAATTGGTCGGCTACCCGATCATCGGGCTGGCCGAACCCCTCGACGTGGTCAATTACGTTCGGCGCCTTGAAGAATCGCTGATCCAAGTCTGCGCCGATCTGGGCCTGCACGCCGGCCGCGTCGACGGCCGGTCCGGGGTCTGGCTGCCCGGCAGGCCGGCGCGCAAGGTCGCGGCCATCGGTGTCCGGGTGTCGCGGGCGACGACACTGCACGGGTTTGCGCTCAACTGCGATTGTGATTTGGCTGCCTTCACCGCCATCGTGCCATGCGGAATCAGTGACGCCGCAGTGACATCGCTGTCCGCCGAACTCGGCCGTACGGTCACCGTCGACGAGGTCCGCGCGACGGTCGCCGCCGCTGTCTGCGCCGCTCTGGACGGCGTCCTACCGGTCGGTGACCGCGTGCCCTCACACGCCGTACCATCGCCGTTATGA
- Drug Resistance
- Mutations
- Function
- Catalyzes the transfer of endogenously produced octanoic acid from octanoyl-acyl-carrier-protein onto the lipoyl domains of lipoate-dependent enzymes. Lipoyl-ACP can also act as a substrate although octanoyl-ACP is likely to be the physiological substrate. {ECO:0000255|HAMAP-Rule:MF_00013, ECO:0000269|PubMed:16735476}.
- Family
-
LipB family
- GO
-
- lipoate biosynthetic process GO:0009107 biological_process
- protein lipoylation GO:0009249 biological_process
- plasma membrane GO:0005886 cellular_component
- cytoplasm GO:0005737 cellular_component
- lipoyl(octanoyl) transferase activity GO:0033819 molecular_function
- octanoyl transferase activity (acting on glycine-cleavage complex H protein) GO:0102555 molecular_function
- InterPro
1W66
- Name
- Octanoyltransferase (EC 2.3.1.181) (Lipoate-protein ligase B) (Lipoyl/octanoyl transferase) (Octanoyl-[acyl-carrier-protein]-protein N-octanoyltransferase)
- Family
- LipB family
- Protein Sequence
-
MTGSIRSKLSAIDVRQLGTVDYRTAWQLQRELADARVAGGADTLLLLEHPAVYTAGRRTETHERPIDGTPVVDTDRGGKITWHGPGQLVGYPIIGLAEPLDVVNYVRRLEESLIQVCADLGLHAGRVDGRSGVWLPGRPARKVAAIGVRVSRATTLHGFALNCDCDLAAFTAIVPCGISDAAVTSLSAELGRTVTVDEVRATVAAAVCAALDGVLPVGDRVPSHAVPSPL
- Mass
- 24,211 Da
- Length
- 230 Aa
Summary
Rv2217 doesn't seem to be a targeted by any drug.
Rv2217 doesn't seem to be involved in any pathway.
- The Mycobacterium tuberculosis LipB enzyme functions as a cysteine/lysine dyad acyltransferase.
- Proc Natl Acad Sci U S A. 2006 Jun 6;103(23):8662-7. doi: 10.1073/pnas.0510436103. Epub 2006 May 30.
- Proteogenomic analysis of Mycobacterium tuberculosis by high resolution mass spectrometry.
- Mol Cell Proteomics. 2011 Dec;10(12):M111.011627. doi: 10.1074/mcp.M111.011445. Epub 2011 Oct 3.
- Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence.
- Nature. 1998 Jun 11;393(6685):537-44. doi: 10.1038/31159.