smtB
- Type
- protein_coding
- Name
- smtB
- Locus Name
-
Rv2358
- Product
-
Probable transcriptional regulatory protein SmtB (probably ArsR-family)
- Functional Category
-
Regulatory proteins
- Location
- 2641246..2641653 (+ strand)
- Gene Length
- 407 bp
- Nucleotides
-
TGGTGACGTCCCCCTCAACGCCGACCGCCGCCCACGAAGATGTGGGTGCCGACGAAGTAGGCGGTCACCAGCATCCCGCGGATAGGTTCGCCGAATGCCCCACGTTCCCCGCACCACCGCCGCGGGAGATCCTAGACGCTGCCGGCGAGCTGCTGCGTGCGCTGGCCGCACCGGTGCGGATCGCCATCGTGCTGCAATTGCGTGAATCTCAACGCTGCGTGCACGAACTGGTCGACGCACTGCACGTGCCCCAGCCGTTGGTCAGCCAACATCTGAAGATCCTCAAGGCGGCGGGCGTGGTCACCGGGGAGCGATCGGGCCGAGAAGTGCTGTACCGACTTGCTGACCACCACCTCGCGCACATTGTGCTCGACGCCGTCGCGCACGCCGGTGAGGACGCAATATGA
- Drug Resistance
- Mutations
- Function
- Transcriptional regulator involved in zinc homeostasis. Represses the expression of the smtB-zur operon in the absence of zinc. Could act as the metal sensor that controls the expression of zur in response to zinc availability. {ECO:0000269|PubMed:16077132}.
- Family
-
Unknown
- GO
-
- transcription regulatory region DNA binding GO:0044212 molecular_function
- metal ion binding GO:0046872 molecular_function
- response to zinc ion GO:0010043 biological_process
- DNA-binding transcription factor activity GO:0003700 molecular_function
- regulation of transcription, DNA-templated GO:0006355 biological_process
- InterPro
Summary
- Name
- HTH-type transcriptional repressor SmtB
- Family
- Unknown
- Protein Sequence
-
MVTSPSTPTAAHEDVGADEVGGHQHPADRFAECPTFPAPPPREILDAAGELLRALAAPVRIAIVLQLRESQRCVHELVDALHVPQPLVSQHLKILKAAGVVTGERSGREVLYRLADHHLAHIVLDAVAHAGEDAI
- Mass
- 14,421 Da
- Length
- 135 Aa
Rv2358 doesn't seem to be a targeted by any drug.
Rv2358 doesn't seem to be involved in any pathway.
- Proteogenomic analysis of Mycobacterium tuberculosis by high resolution mass spectrometry.
- Mol Cell Proteomics. 2011 Dec;10(12):M111.011627. doi: 10.1074/mcp.M111.011445. Epub 2011 Oct 3.
- Rv2358 and FurB: two transcriptional regulators from Mycobacterium tuberculosis which respond to zinc.
- J Bacteriol. 2005 Aug;187(16):5837-40. doi: 10.1128/JB.187.16.5837-5840.2005.
- The Mycobacterium tuberculosis Rv2358-furB operon is induced by zinc.
- Res Microbiol. 2004 Apr;155(3):192-200. doi: 10.1016/j.resmic.2003.11.009.
- Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence.
- Nature. 1998 Jun 11;393(6685):537-44. doi: 10.1038/31159.