Rv2361c
- Type
- protein_coding
- Name
- Rv2361c
- Locus Name
-
Rv2361c
- Product
-
Long (C50) chain Z-isoprenyl diphosphate synthase (Z-decaprenyl diphosphate synthase)
- Functional Category
-
Cell wall and cell processes
- Location
- 2642578..2643468 (- strand)
- Gene Length
- 890 bp
- Nucleotides
-
GTGGCTAGGGATGCACGGAAGCGGACGTCCAGCAACTTCCCGCAGCTGCCTCCGGCCCCCGACGACTACCCGACCTTTCCTGATACGTCGACGTGGCCCGTCGTCTTCCCGGAGTTGCCGGCAGCGCCCTACGGAGGCCCCTGCCGGCCACCGCAGCACACTTCGAAAGCGGCCGCGCCACGAATACCGGCCGACCGGCTGCCCAACCATGTCGCCATTGTCATGGACGGCAATGGCCGCTGGGCCACCCAACGTGGGCTGGCCCGCACCGAAGGTCACAAGATGGGCGAGGCGGTGGTGATCGACATCGCTTGCGGTGCTATCGAACTTGGGATCAAGTGGCTCAGCCTCTACGCCTTCTCCACGGAGAACTGGAAGCGTTCGCCCGAGGAAGTCCGCTTCCTGATGGGCTTCAACCGCGACGTGGTGCGACGGCGCCGAGACACCCTAAAGAAGCTAGGGGTCCGGATCCGGTGGGTGGGTTCACGACCACGGCTGTGGCGTAGCGTCATCAATGAGTTGGCGGTCGCGGAGGAGATGACCAAAAGCAACGACGTCATCACCATCAACTATTGCGTCAACTACGGCGGACGCACCGAAATCACCGAAGCCACCCGCGAAATCGCTCGTGAGGTCGCCGCGGGCAGGCTCAACCCGGAGCGGATCACCGAATCCACGATCGCCCGCCACCTGCAGCGACCCGACATTCCCGACGTTGACCTCTTCCTGCGGACCTCGGGTGAGCAGCGCTCCAGCAACTTCATGCTGTGGCAGGCGGCCTACGCTGAATACATATTCCAGGACAAGCTCTGGCCCGACTATGACCGCCGCGACTTGTGGGCGGCCTGCGAGGAATACGCGTCGCGCACTCGGCGGTTCGGGAGCGCCTA
- Drug Resistance
- Mutations
- Function
- Catalyzes the sequential condensation of isopentenyl diphosphate (IPP) in the cis configuration with (2Z,6E)-farnesyl diphosphate (Z-FPP or EZ-FPP) generating the 50 carbon product trans,polycis-decaprenyl diphosphate. When (2E,6E)-farnesyl diphosphate (E-FPP or EE-FPP) is used in vitro, both primary products decaprenyl diphosphate and (2E,6E,10E)-geranylgeranyl diphosphate (EEE-GGPP) are synthesized. M.tuberculosis does not synthesize (2E,6E,10Z)-geranylgeranyl diphosphate (EEZ-GGPP) and heptaprenyl diphosphate. Can also accept many different allylic substrates, including E-geranyl diphosphate (E-GPP), neryl diphosphate (NPP), and all-trans-geranyl-geranyl diphosphate. {ECO:0000269|PubMed:10816587, ECO:0000269|PubMed:11004176, ECO:0000269|PubMed:15516568}.
- Family
-
UPP synthase family
- GO
-
- magnesium ion binding GO:0000287 molecular_function
- trans-octaprenyltranstransferase activity GO:0050347 molecular_function
- manganese ion binding GO:0030145 molecular_function
- cytosol GO:0005829 cellular_component
- plasma membrane GO:0005886 cellular_component
- Z-farnesyl diphosphate synthase activity GO:0033850 molecular_function
- di-trans,poly-cis-decaprenylcistransferase activity GO:0008834 molecular_function
- polyprenol biosynthetic process GO:0016094 biological_process
- polyprenyltransferase activity GO:0002094 molecular_function
- InterPro
2VG2
- Name
- Decaprenyl diphosphate synthase (DecaPP) (EC 2.5.1.86) (EC 2.5.1.87) (Decaprenyl pyrophosphate synthase) (Long-chain isoprenyl diphosphate synthase) (Trans,polycis-decaprenyl diphosphate synthase)
- Family
- UPP synthase family
- Protein Sequence
-
MARDARKRTSSNFPQLPPAPDDYPTFPDTSTWPVVFPELPAAPYGGPCRPPQHTSKAAAPRIPADRLPNHVAIVMDGNGRWATQRGLARTEGHKMGEAVVIDIACGAIELGIKWLSLYAFSTENWKRSPEEVRFLMGFNRDVVRRRRDTLKKLGVRIRWVGSRPRLWRSVINELAVAEEMTKSNDVITINYCVNYGGRTEITEATREIAREVAAGRLNPERITESTIARHLQRPDIPDVDLFLRTSGEQRSSNFMLWQAAYAEYIFQDKLWPDYDRRDLWAACEEYASRTRRFGSA
- Mass
- 33,791 Da
- Length
- 296 Aa
Summary
Rv2361c doesn't seem to be a targeted by any drug.
-
-
Terpenoid backbone biosynthesis mtu00900
mtu00900Metabolism; Metabolism of terpenoids and polyketides
-
- The structural basis of chain length control in Rv1086.
- J Mol Biol. 2008 Aug 1;381(1):129-40. doi: 10.1016/j.jmb.2008.05.060. Epub 2008 Jul 1.
- Proteogenomic analysis of Mycobacterium tuberculosis by high resolution mass spectrometry.
- Mol Cell Proteomics. 2011 Dec;10(12):M111.011627. doi: 10.1074/mcp.M111.011445. Epub 2011 Oct 3.
- Decaprenyl diphosphate synthesis in Mycobacterium tuberculosis.
- J Bacteriol. 2004 Nov;186(22):7564-70. doi: 10.1128/JB.186.22.7564-7570.2004.
- Identification of a short (C15) chain Z-isoprenyl diphosphate synthase and a homologous long (C50) chain isoprenyl diphosphate synthase in Mycobacterium tuberculosis.
- J Biol Chem. 2000 Jul 28;275(30):22876-81. doi: 10.1074/jbc.M003194200.
- Polyprenyl phosphate biosynthesis in Mycobacterium tuberculosis and Mycobacterium smegmatis.
- J Bacteriol. 2000 Oct;182(20):5771-8. doi: 10.1128/jb.182.20.5771-5778.2000.
- Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence.
- Nature. 1998 Jun 11;393(6685):537-44. doi: 10.1038/31159.