eis



Type
protein_coding
Name
eis
Locus Name

Rv2416c

Product

Enhanced intracellular survival protein Eis,GCN5-related N-acetyltransferase

Functional Category

Virulence, detoxification, adaptation

Location
2714124..2715332 (- strand)
Gene Length
1208 bp
Nucleotides
GTGACTGTGACCCTGTGTAGCCCGACCGAGGACGACTGGCCGGGGATGTTCCTACTGGCCGCGGCCAGTTTCACCGATTTCATCGGCCCTGAATCAGCGACCGCCTGGCGGACCCTGGTGCCCACCGACGGAGCGGTGGTGGTCCGCGATGGTGCCGGCCCGGGTTCTGAGGTGGTCGGGATGGCGCTGTACATGGATCTGCGGTTGACGGTGCCTGGTGAAGTGGTGCTCCCGACCGCCGGTCTCAGTTTCGTCGCGGTGGCGCCGACGCATCGCCGGCGCGGCTTGCTGCGCGCGATGTGCGCCGAACTGCACCGCCGCATAGCCGATTCCGGCTATCCGGTCGCGGCACTGCATGCTAGCGAGGGCGGCATCTACGGCCGGTTCGGCTACGGGCCCGCTACCACCTTGCATGAGCTGACGGTCGACCGACGCTTCGCGCGCTTTCACGCCGACGCACCGGGCGGCGGCCTAGGTGGCAGCAGCGTCCGGTTGGTCAGACCCACCGAGCATCGCGGCGAGTTTGAGGCGATCTACGAGCGATGGCGCCAGCAGGTGCCGGGCGGGCTGCTACGCCCGCAGGTGCTCTGGGACGAGCTGCTGGCAGAATGCAAAGCCGCGCCCGGTGGAGACCGTGAATCGTTCGCGTTACTGCATCCCGACGGGTACGCGCTGTACCGGGTGGATCGCACCGATCTCAAGCTAGCGCGCGTCAGCGAACTCAGGGCGGTAACCGCAGATGCGCATTGTGCGTTGTGGCGGGCCCTGATTGGCCTCGACTCCATGGAGCGAATCAGCATCATCACCCATCCACAGGACCCGTTACCCCACCTGCTCACCGATACCCGACTGGCCCGCACTACCTGGCGCCAGGACGGCCTGTGGTTGCGCATCATGAACGTACCGGCCGCACTCGAGGCGCGTGGTTACGCTCACGAAGTTGGCGAGTTTTCCACGGTCCTCGAGGTATCCGATGGCGGCCGGTTCGCGCTCAAGATCGGTGACGGCCGTGCGCGGTGTACCCCGACCGATGCGGCAGCCGAGATCGAAATGGATCGGGACGTACTGGGCAGCCTTTACCTTGGAGCGCACCGCGCTTCGACGTTAGCCGCCGCTAACCGGTTGCGCACCAAAGATTCCCAGCTGCTTCGTCGACTCGACGCGGCGTTTGCCAGTGATGTTCCCGTCCAGACCGCGTTCGAGTTCTG
Drug Resistance

Check for drug resistance association at TBDREAMDB

Mutations

Check for mutants available at TARGET


Function
Effector that is released into the host cell and affects host immune responses; it negatively modulates inflammation, macrophage autophagy, and cell death through redox-dependent signaling (PubMed:17259625, PubMed:21187903). Acts as an acetyltransferase. Acetylates 'Lys-55' of dual-specificity protein phosphatase 16 (DUSP16)/mitogen-activated protein kinase phosphatase-7 (MKP-7), a JNK-specific phosphatase; this leads to the inhibition of JNK-dependent autophagy, phagosome maturation, and ROS (reactive oxygen species) generation for enhanced intracellular survival of M.tuberculosis (PubMed:22547814). Inhibits Con A-mediated T-cell proliferation in vitro (PubMed:17449476). Treatment of T-cells with Eis inhibits ERK1/2, JAK pathway, and subsequent production of tumor necrosis factor-alpha (TNF-alpha) and interleukin-4 (IL-4); on the contrary, there is increased production of interferon-gamma (IFN-gamma) and interleukin-10 (IL-10), which indicates that immunity in response to Eis treatment is skewed away from a protective T(H)1 response and Eis disturbs the cross regulation of T-cells (PubMed:17449476). When expressed in M.smegmatis, enhances intracellular survival of the bacteria in host macrophages during infection (PubMed:10629183). {ECO:0000269|PubMed:10629183, ECO:0000269|PubMed:17259625, ECO:0000269|PubMed:17449476, ECO:0000269|PubMed:21187903, ECO:0000269|PubMed:22547814}.; FUNCTION: Can also acetylate multiple amine groups of many aminoglycoside (AG) antibiotics, leading to their inactivation, and thus contributes to drug resistance (PubMed:19906990, PubMed:21628583, PubMed:24106131). Is also able to acetylate and deactivate the cyclic peptide antibiotic capreomycin, but not the other anti-tuberculous drugs isoniazid and pyrazinamide (PubMed:23233486). Acetylates kanamycin (KAN) more efficiently than amikacin (AMK), even though Eis seems to bind AMK with higher affinity (PubMed:19906990). Does not acetylate and inactivate streptomycin, apramycin and spectinomycin (PubMed:19906990, PubMed:21628583). {ECO:0000269|PubMed:19906990, ECO:0000269|PubMed:21628583, ECO:0000269|PubMed:23233486, ECO:0000269|PubMed:24106131}.
Family

Acetyltransferase Eis family

GO
InterPro

UniProt
P9WFK7
GenBank
Rv2416c
EnsemblBacteria
Rv2416c
Mycobrowser
Rv2416c


3R1K
Summary
Name
N-acetyltransferase Eis (EC 2.3.1.-) (Aminoglycoside N-acetyltransferase) (Enhanced intracellular survival protein) (Protein-lysine N-acetyltransferase)
Family
Acetyltransferase Eis family
Protein Sequence
MTVTLCSPTEDDWPGMFLLAAASFTDFIGPESATAWRTLVPTDGAVVVRDGAGPGSEVVGMALYMDLRLTVPGEVVLPTAGLSFVAVAPTHRRRGLLRAMCAELHRRIADSGYPVAALHASEGGIYGRFGYGPATTLHELTVDRRFARFHADAPGGGLGGSSVRLVRPTEHRGEFEAIYERWRQQVPGGLLRPQVLWDELLAECKAAPGGDRESFALLHPDGYALYRVDRTDLKLARVSELRAVTADAHCALWRALIGLDSMERISIITHPQDPLPHLLTDTRLARTTWRQDGLWLRIMNVPAALEARGYAHEVGEFSTVLEVSDGGRFALKIGDGRARCTPTDAAAEIEMDRDVLGSLYLGAHRASTLAAANRLRTKDSQLLRRLDAAFASDVPVQTAFEF
Mass
43,804 Da
Length
402 Aa

Rv2416c doesn't seem to be a targeted by any drug.


Rv2416c doesn't seem to be involved in any pathway.


Potent Inhibitors of Acetyltransferase Eis Overcome Kanamycin Resistance in Mycobacterium tuberculosis.
ACS Chem Biol. 2016 Jun 17;11(6):1639-46. doi: 10.1021/acschembio.6b00110. Epub 2016 Apr 7.
Chemical and structural insights into the regioversatility of the aminoglycoside acetyltransferase Eis.
Chembiochem. 2013 Nov 4;14(16):2127-35. doi: 10.1002/cbic.201300359. Epub 2013 Sep 17.
Mycobacterium tuberculosis Eis protein initiates suppression of host immune responses by acetylation of DUSP16/MKP-7.
Proc Natl Acad Sci U S A. 2012 May 15;109(20):7729-34. doi: 10.1073/pnas.1120251109. Epub 2012 Apr 30.
Unusual regioversatility of acetyltransferase Eis, a cause of drug resistance in XDR-TB.
Proc Natl Acad Sci U S A. 2011 Jun 14;108(24):9804-8. doi: 10.1073/pnas.1105379108. Epub 2011 May 31.
Unexpected N-acetylation of capreomycin by mycobacterial Eis enzymes.
J Antimicrob Chemother. 2013 Apr;68(4):800-5. doi: 10.1093/jac/dks497. Epub 2012 Dec 11.
Proteogenomic analysis of Mycobacterium tuberculosis by high resolution mass spectrometry.
Mol Cell Proteomics. 2011 Dec;10(12):M111.011627. doi: 10.1074/mcp.M111.011445. Epub 2011 Oct 3.
Mycobacterium tuberculosis eis regulates autophagy, inflammation, and cell death through redox-dependent signaling.
PLoS Pathog. 2010 Dec 16;6(12):e1001230. doi: 10.1371/journal.ppat.1001230.
Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence.
Nature. 1998 Jun 11;393(6685):537-44. doi: 10.1038/31159.
Identification of a Mycobacterium tuberculosis gene that enhances mycobacterial survival in macrophages.
J Bacteriol. 2000 Jan;182(2):377-84. doi: 10.1128/jb.182.2.377-384.2000.
Subcellular localization of the Iitracellular survival-enhancing Eis protein of Mycobacterium tuberculosis.
Infect Immun. 2001 Jul;69(7):4295-302. doi: 10.1128/IAI.69.7.4295-4302.2001.
Eis (enhanced intracellular survival) protein of Mycobacterium tuberculosis disturbs the cross regulation of T-cells.
J Biol Chem. 2007 Jun 29;282(26):18671-5. doi: 10.1074/jbc.C600280200. Epub 2007 Apr 19.
Expression, production and release of the Eis protein by Mycobacterium tuberculosis during infection of macrophages and its effect on cytokine secretion.
Microbiology. 2007 Feb;153(Pt 2):529-40. doi: 10.1099/mic.0.2006/002642-0.
Overexpression of the chromosomally encoded aminoglycoside acetyltransferase eis confers kanamycin resistance in Mycobacterium tuberculosis.
Proc Natl Acad Sci U S A. 2009 Nov 24;106(47):20004-9. doi: 10.1073/pnas.0907925106. Epub 2009 Nov 11.