Rv2420c
- Type
- protein_coding
- Name
- Rv2420c
- Locus Name
-
Rv2420c
- Product
-
Conserved hypothetical protein
- Functional Category
-
Conserved hypotheticals
- Location
- 2717796..2718176 (- strand)
- Gene Length
- 380 bp
- Nucleotides
-
ATGACCGCCAACCGGGAAGCCATCGACATGGCGAGGGTGGCCGCCGGCGCGGCCGCCGCCAAGCTCGCCGATGACGTCGTGGTCATCGATGTCTCCGGGCAGCTGGTCATCACCGACTGCTTCGTCATTGCTTCGGGCTCCAACGAGCGGCAGGTCAACGCCATCGTCGATGAGGTCGAGGAGAAAATGCGACAGGCGGGTTACCGGCCGGCCCGCCGTGAGGGTGCCCGCGAGGGTCGCTGGACGCTGTTGGATTACCGGGACATCGTGGTGCACATCCAGCATCAGGACGACCGCAATTTCTACGCCCTGGACCGGTTGTGGGGTGACTGCCCGGTGGTGCCGGTTGATTTATCGGCGAACTCAGCGGGTGCGCAATG
- Drug Resistance
- Mutations
- Function
- Functions as a ribosomal silencing factor. Interacts with ribosomal protein L14 (rplN), blocking formation of intersubunit bridge B8. Prevents association of the 30S and 50S ribosomal subunits and the formation of functional ribosomes, thus repressing translation. {ECO:0000256|HAMAP-Rule:MF_01477}.
- Family
-
Iojap/RsfS family
- GO
-
- mature ribosome assembly GO:0042256 biological_process
- ribosomal large subunit binding GO:0043023 molecular_function
- negative regulation of translation GO:0017148 biological_process
- identical protein binding GO:0042802 molecular_function
- cytoplasm GO:0005737 cellular_component
- negative regulation of ribosome biogenesis GO:0090071 biological_process
- InterPro
4WCW
- Name
- Ribosomal silencing factor RsfS
- Family
- Iojap/RsfS family
- Protein Sequence
-
MTANREAIDMARVAAGAAAAKLADDVVVIDVSGQLVITDCFVIASGSNERQVNAIVDEVEEKMRQAGYRPARREGAREGRWTLLDYRDIVVHIQHQDDRNFYALDRLWGDCPVVPVDLSANSAGAQ
- Mass
- 13,827 Da
- Length
- 126 Aa
Summary
Rv2420c doesn't seem to be a targeted by any drug.
Rv2420c doesn't seem to be involved in any pathway.
- Structure of Ribosomal Silencing Factor Bound to Mycobacterium tuberculosis Ribosome.
- Structure. 2015 Oct 6;23(10):1858-1865. doi: 10.1016/j.str.2015.07.014. Epub 2015 Aug 20.
- Proteogenomic analysis of Mycobacterium tuberculosis by high resolution mass spectrometry.
- Mol Cell Proteomics. 2011 Dec;10(12):M111.011627. doi: 10.1074/mcp.M111.011445. Epub 2011 Oct 3.
- Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence.
- Nature. 1998 Jun 11;393(6685):537-44. doi: 10.1038/31159.